Incidental Mutation 'R5404:Rbm5'
ID428631
Institutional Source Beutler Lab
Gene Symbol Rbm5
Ensembl Gene ENSMUSG00000032580
Gene NameRNA binding motif protein 5
SynonymsD030069N10Rik
MMRRC Submission 042975-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.944) question?
Stock #R5404 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location107740371-107770996 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 107765553 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 94 (E94G)
Ref Sequence ENSEMBL: ENSMUSP00000138379 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035199] [ENSMUST00000182022] [ENSMUST00000182304] [ENSMUST00000182371] [ENSMUST00000182421] [ENSMUST00000182659] [ENSMUST00000183248] [ENSMUST00000192130]
Predicted Effect probably damaging
Transcript: ENSMUST00000035199
AA Change: E94G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000035199
Gene: ENSMUSG00000032580
AA Change: E94G

DomainStartEndE-ValueType
low complexity region 21 74 N/A INTRINSIC
RRM 99 174 5.98e-13 SMART
ZnF_RBZ 183 207 1.53e-6 SMART
RRM 232 311 9.5e-7 SMART
low complexity region 329 355 N/A INTRINSIC
low complexity region 362 385 N/A INTRINSIC
low complexity region 393 410 N/A INTRINSIC
low complexity region 425 446 N/A INTRINSIC
Blast:RRM_2 483 506 1e-5 BLAST
low complexity region 520 536 N/A INTRINSIC
low complexity region 569 581 N/A INTRINSIC
low complexity region 627 641 N/A INTRINSIC
ZnF_C2H2 647 672 5.2e0 SMART
coiled coil region 673 707 N/A INTRINSIC
G_patch 741 787 1.85e-21 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181993
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182007
Predicted Effect probably damaging
Transcript: ENSMUST00000182022
AA Change: E94G

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000138390
Gene: ENSMUSG00000032580
AA Change: E94G

DomainStartEndE-ValueType
low complexity region 21 74 N/A INTRINSIC
SCOP:d1h6kx_ 96 137 2e-3 SMART
Blast:RRM 99 137 3e-20 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182073
Predicted Effect possibly damaging
Transcript: ENSMUST00000182304
AA Change: E94G

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000138380
Gene: ENSMUSG00000032580
AA Change: E94G

DomainStartEndE-ValueType
low complexity region 21 74 N/A INTRINSIC
RRM 99 174 5.98e-13 SMART
ZnF_RBZ 183 207 1.53e-6 SMART
PDB:2LKZ|A 231 251 5e-6 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000182371
AA Change: E94G

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000138119
Gene: ENSMUSG00000032580
AA Change: E94G

DomainStartEndE-ValueType
low complexity region 21 74 N/A INTRINSIC
SCOP:d1h6kx_ 96 138 6e-3 SMART
Blast:RRM 99 136 3e-19 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000182421
AA Change: R93G

PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000138778
Gene: ENSMUSG00000032580
AA Change: R93G

DomainStartEndE-ValueType
low complexity region 21 59 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182518
Predicted Effect probably damaging
Transcript: ENSMUST00000182659
AA Change: E94G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000138379
Gene: ENSMUSG00000032580
AA Change: E94G

DomainStartEndE-ValueType
low complexity region 21 74 N/A INTRINSIC
RRM 99 174 5.98e-13 SMART
ZnF_RBZ 183 207 1.53e-6 SMART
RRM 232 311 9.5e-7 SMART
low complexity region 329 355 N/A INTRINSIC
low complexity region 362 385 N/A INTRINSIC
low complexity region 393 410 N/A INTRINSIC
low complexity region 425 446 N/A INTRINSIC
Blast:RRM_2 483 506 1e-5 BLAST
low complexity region 520 536 N/A INTRINSIC
low complexity region 569 581 N/A INTRINSIC
low complexity region 627 641 N/A INTRINSIC
ZnF_C2H2 647 672 5.2e0 SMART
coiled coil region 673 707 N/A INTRINSIC
G_patch 741 787 1.85e-21 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000183248
AA Change: E94G

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000138294
Gene: ENSMUSG00000032580
AA Change: E94G

DomainStartEndE-ValueType
low complexity region 21 74 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183307
Predicted Effect probably damaging
Transcript: ENSMUST00000192130
AA Change: E94G

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000142194
Gene: ENSMUSG00000032580
AA Change: E94G

DomainStartEndE-ValueType
low complexity region 21 74 N/A INTRINSIC
SCOP:d1h6kx_ 96 138 6e-3 SMART
Blast:RRM 99 136 3e-19 BLAST
Predicted Effect unknown
Transcript: ENSMUST00000193342
AA Change: E51G
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194573
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194801
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a candidate tumor suppressor gene which encodes a nuclear RNA binding protein that is a component of the spliceosome A complex. The encoded protein plays a role in the induction of cell cycle arrest and apoptosis through pre-mRNA splicing of multiple target genes including the tumor suppressor protein p53. This gene is located within the tumor suppressor region 3p21.3, and may play a role in the inhibition of tumor transformation and progression of several malignancies including lung cancer. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit male infertility with azoospermia, male germ cell apoptosis, round spermatid arrest and spermatid differentiation arrest. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1bg T C 15: 60,919,696 H297R probably benign Het
Ccnk A T 12: 108,195,623 K262N possibly damaging Het
Clec4b2 A T 6: 123,181,349 Y58F probably benign Het
Cp A C 3: 19,989,128 T1027P possibly damaging Het
Cpox G A 16: 58,675,286 G322D probably damaging Het
Cry1 T C 10: 85,184,419 N18S probably damaging Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Dock10 A G 1: 80,503,913 probably benign Het
Fance A T 17: 28,318,060 R58W probably null Het
Fermt1 T C 2: 132,934,869 D233G possibly damaging Het
Gabpa T A 16: 84,860,463 Y409N probably damaging Het
Gpr162 A G 6: 124,861,643 S15P possibly damaging Het
Grid2 T A 6: 63,930,910 I178N probably damaging Het
Il17re T C 6: 113,469,102 V233A probably benign Het
Lemd3 G A 10: 120,931,958 Q672* probably null Het
Myh15 A G 16: 49,159,978 T1488A probably benign Het
Narf T A 11: 121,242,626 H84Q probably benign Het
Nedd1 C T 10: 92,716,192 V69I probably benign Het
Nfil3 G A 13: 52,968,055 S271F probably damaging Het
Npc1 A G 18: 12,213,299 L280P possibly damaging Het
Olfr1181 C T 2: 88,423,801 V75M probably damaging Het
Olfr138 T A 17: 38,275,626 L285* probably null Het
Olfr559 T A 7: 102,723,600 I297F possibly damaging Het
Poli A G 18: 70,509,432 S503P probably benign Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Rps6ka5 T C 12: 100,616,093 I173M probably damaging Het
Slc40a1 A G 1: 45,912,328 L223P probably damaging Het
Smg1 T C 7: 118,206,908 K213E probably damaging Het
Spem1 T A 11: 69,820,937 K300N probably damaging Het
Tchh A G 3: 93,447,675 E1474G unknown Het
Tenm4 A T 7: 96,894,680 R1968W probably damaging Het
Tshz2 A T 2: 169,884,320 M279L probably benign Het
Tuba3a G T 6: 125,281,592 T145K possibly damaging Het
Other mutations in Rbm5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02041:Rbm5 APN 9 107755846 unclassified probably benign
IGL02319:Rbm5 APN 9 107743865 nonsense probably null
IGL02567:Rbm5 APN 9 107744274 missense probably damaging 1.00
IGL02868:Rbm5 APN 9 107749700 splice site probably benign
IGL02943:Rbm5 APN 9 107744343 missense probably damaging 1.00
IGL02959:Rbm5 APN 9 107754185 unclassified probably benign
IGL03029:Rbm5 APN 9 107754453 missense possibly damaging 0.46
PIT4403001:Rbm5 UTSW 9 107760336 missense probably damaging 1.00
R0001:Rbm5 UTSW 9 107742424 missense probably damaging 1.00
R0242:Rbm5 UTSW 9 107751708 splice site probably benign
R1170:Rbm5 UTSW 9 107742497 missense probably damaging 0.99
R1239:Rbm5 UTSW 9 107752966 unclassified probably benign
R1297:Rbm5 UTSW 9 107744242 missense probably damaging 1.00
R1719:Rbm5 UTSW 9 107743913 critical splice acceptor site probably null
R1764:Rbm5 UTSW 9 107767564 nonsense probably null
R1826:Rbm5 UTSW 9 107742414 missense probably damaging 0.98
R1863:Rbm5 UTSW 9 107750519 missense possibly damaging 0.70
R4112:Rbm5 UTSW 9 107765597 missense probably damaging 1.00
R4207:Rbm5 UTSW 9 107750483 missense probably benign
R4343:Rbm5 UTSW 9 107752196 missense probably damaging 1.00
R4441:Rbm5 UTSW 9 107749688 intron probably benign
R4621:Rbm5 UTSW 9 107754146 missense probably damaging 1.00
R4767:Rbm5 UTSW 9 107745213 missense probably damaging 1.00
R5090:Rbm5 UTSW 9 107760312 splice site probably benign
R5876:Rbm5 UTSW 9 107760326 missense probably damaging 1.00
R5959:Rbm5 UTSW 9 107752140 missense probably benign 0.02
R5983:Rbm5 UTSW 9 107744942 missense probably damaging 1.00
R5984:Rbm5 UTSW 9 107744942 missense probably damaging 1.00
R7436:Rbm5 UTSW 9 107750394 intron probably null
R7447:Rbm5 UTSW 9 107746179 missense probably damaging 1.00
R7867:Rbm5 UTSW 9 107751731 missense probably benign 0.02
R7950:Rbm5 UTSW 9 107751731 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- AATACTTTCCTTCAGTTCACCAAG -3'
(R):5'- ACCATTCTTCACAACTAAGAGAATG -3'

Sequencing Primer
(F):5'- CCATGAGACAACGAGTAAG -3'
(R):5'- AGCTATTCTTGCAGAGGCTCCAG -3'
Posted On2016-09-06