Incidental Mutation 'R5404:Cry1'
ID428633
Institutional Source Beutler Lab
Gene Symbol Cry1
Ensembl Gene ENSMUSG00000020038
Gene Namecryptochrome 1 (photolyase-like)
SynonymsPhll1
MMRRC Submission 042975-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5404 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location85131700-85185064 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 85184419 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 18 (N18S)
Ref Sequence ENSEMBL: ENSMUSP00000020227 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020227]
PDB Structure Crystal Structure of Mouse Cryptochrome1 in Complex with Period2 [X-RAY DIFFRACTION]
Crystal structure of mouse Cryptochrome 1 [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000020227
AA Change: N18S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000020227
Gene: ENSMUSG00000020038
AA Change: N18S

DomainStartEndE-ValueType
Pfam:DNA_photolyase 5 168 1.4e-47 PFAM
Pfam:FAD_binding_7 213 486 6.9e-91 PFAM
internal_repeat_1 502 523 3.57e-8 PROSPERO
internal_repeat_1 521 543 3.57e-8 PROSPERO
low complexity region 544 555 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a flavin adenine dinucleotide-binding protein that is a key component of the circadian core oscillator complex, which regulates the circadian clock. This gene is upregulated by Clock/Arntl heterodimers but then represses this upregulation in a feedback loop using Per/Cry heterodimers to interact with Clock/Arntl. Polymorphisms in this gene have been associated with altered sleep patterns. The encoded protein is widely conserved across plants and animals. Loss of this gene results in a shortened circadian cycle in complete darkness. [provided by RefSeq, Feb 2014]
PHENOTYPE: Homozygotes for targeted null mutations exhibit a one-hour shorter circadian period under constant darkness and reduced expression of another circadian gene in the suprachiasmatic nucleus in response to acute light exposure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1bg T C 15: 60,919,696 H297R probably benign Het
Ccnk A T 12: 108,195,623 K262N possibly damaging Het
Clec4b2 A T 6: 123,181,349 Y58F probably benign Het
Cp A C 3: 19,989,128 T1027P possibly damaging Het
Cpox G A 16: 58,675,286 G322D probably damaging Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Dock10 A G 1: 80,503,913 probably benign Het
Fance A T 17: 28,318,060 R58W probably null Het
Fermt1 T C 2: 132,934,869 D233G possibly damaging Het
Gabpa T A 16: 84,860,463 Y409N probably damaging Het
Gpr162 A G 6: 124,861,643 S15P possibly damaging Het
Grid2 T A 6: 63,930,910 I178N probably damaging Het
Il17re T C 6: 113,469,102 V233A probably benign Het
Lemd3 G A 10: 120,931,958 Q672* probably null Het
Myh15 A G 16: 49,159,978 T1488A probably benign Het
Narf T A 11: 121,242,626 H84Q probably benign Het
Nedd1 C T 10: 92,716,192 V69I probably benign Het
Nfil3 G A 13: 52,968,055 S271F probably damaging Het
Npc1 A G 18: 12,213,299 L280P possibly damaging Het
Olfr1181 C T 2: 88,423,801 V75M probably damaging Het
Olfr138 T A 17: 38,275,626 L285* probably null Het
Olfr559 T A 7: 102,723,600 I297F possibly damaging Het
Poli A G 18: 70,509,432 S503P probably benign Het
Rbm5 T C 9: 107,765,553 E94G probably damaging Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Rps6ka5 T C 12: 100,616,093 I173M probably damaging Het
Slc40a1 A G 1: 45,912,328 L223P probably damaging Het
Smg1 T C 7: 118,206,908 K213E probably damaging Het
Spem1 T A 11: 69,820,937 K300N probably damaging Het
Tchh A G 3: 93,447,675 E1474G unknown Het
Tenm4 A T 7: 96,894,680 R1968W probably damaging Het
Tshz2 A T 2: 169,884,320 M279L probably benign Het
Tuba3a G T 6: 125,281,592 T145K possibly damaging Het
Other mutations in Cry1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00234:Cry1 APN 10 85146834 missense probably benign 0.11
IGL00737:Cry1 APN 10 85143040 missense probably benign 0.02
IGL01349:Cry1 APN 10 85148739 missense probably benign 0.00
IGL01544:Cry1 APN 10 85146496 nonsense probably null
IGL01545:Cry1 APN 10 85184362 missense possibly damaging 0.94
IGL01767:Cry1 APN 10 85146474 missense probably damaging 1.00
IGL03392:Cry1 APN 10 85157129 missense possibly damaging 0.88
R0119:Cry1 UTSW 10 85133240 critical splice donor site probably null
R0605:Cry1 UTSW 10 85184359 missense probably damaging 0.96
R1618:Cry1 UTSW 10 85146454 missense probably damaging 1.00
R1955:Cry1 UTSW 10 85144178 missense probably benign 0.00
R2209:Cry1 UTSW 10 85146755 missense probably damaging 0.98
R2221:Cry1 UTSW 10 85143753 missense probably damaging 1.00
R2223:Cry1 UTSW 10 85143753 missense probably damaging 1.00
R2314:Cry1 UTSW 10 85133311 missense probably benign 0.08
R3851:Cry1 UTSW 10 85146499 missense probably benign 0.15
R3872:Cry1 UTSW 10 85133160 critical splice acceptor site probably null
R3981:Cry1 UTSW 10 85146592 missense probably damaging 0.99
R4856:Cry1 UTSW 10 85148770 missense probably damaging 0.97
R5162:Cry1 UTSW 10 85133286 missense probably benign
R5449:Cry1 UTSW 10 85133135 missense probably benign 0.17
R5484:Cry1 UTSW 10 85146724 splice site probably null
R5599:Cry1 UTSW 10 85144250 missense probably benign 0.14
R5717:Cry1 UTSW 10 85146416 missense probably damaging 1.00
R7031:Cry1 UTSW 10 85148662 missense probably benign 0.00
R7371:Cry1 UTSW 10 85147919 missense probably benign 0.03
R7943:Cry1 UTSW 10 85143120 missense probably benign 0.03
R8022:Cry1 UTSW 10 85146402 missense probably damaging 0.97
R8290:Cry1 UTSW 10 85143113 nonsense probably null
R8805:Cry1 UTSW 10 85157105 missense probably benign 0.09
Z1176:Cry1 UTSW 10 85144197 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCTGACACTAACGCATCGAC -3'
(R):5'- AGCCTCCATTCATCTGCCAG -3'

Sequencing Primer
(F):5'- TCGACACCCGACTCGCG -3'
(R):5'- ATTCATCTGCCAGCTGCG -3'
Posted On2016-09-06