Mutagenetix > Incidental Mutation

Incidental Mutation 'R5404:Nedd1'

428634

Institutional Source

Beutler Lab

Gene Symbol

Nedd1

Ensembl Gene

ENSMUSG00000019988

Gene Name

neural precursor cell expressed, developmentally down-regulated gene 1

Synonyms

MMRRC Submission

042975-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.962) question?

Stock #

R5404 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

92684746-92722420 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 92716192 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Isoleucine at position 69 (V69I)

Ref Sequence

ENSEMBL: ENSMUSP00000020163 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020163] [ENSMUST00000216086]

AlphaFold

P33215

Predicted Effect

probably benign
Transcript: ENSMUST00000020163
AA Change: V69I

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000020163
Gene: ENSMUSG00000019988
AA Change: V69I

Domain	Start	End	E-Value	Type
WD40	21	63	5.97e-1	SMART
WD40	67	105	9.75e-3	SMART
WD40	108	147	6.19e-5	SMART
WD40	149	191	6.42e-1	SMART
WD40	194	235	9.1e-3	SMART
WD40	238	276	2.24e-2	SMART
low complexity region	555	568	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000213901

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000214417

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000215970

Predicted Effect

probably benign
Transcript: ENSMUST00000216086

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.6%
20x: 96.0%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 33 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A1bg	T	C	15: 60,919,696	H297R	probably benign	Het
Ccnk	A	T	12: 108,195,623	K262N	possibly damaging	Het
Clec4b2	A	T	6: 123,181,349	Y58F	probably benign	Het
Cp	A	C	3: 19,989,128	T1027P	possibly damaging	Het
Cpox	G	A	16: 58,675,286	G322D	probably damaging	Het
Cry1	T	C	10: 85,184,419	N18S	probably damaging	Het
Dnah8	G	A	17: 30,748,568	D2585N	probably benign	Het
Dock10	A	G	1: 80,503,913		probably benign	Het
Fance	A	T	17: 28,318,060	R58W	probably null	Het
Fermt1	T	C	2: 132,934,869	D233G	possibly damaging	Het
Gabpa	T	A	16: 84,860,463	Y409N	probably damaging	Het
Gpr162	A	G	6: 124,861,643	S15P	possibly damaging	Het
Grid2	T	A	6: 63,930,910	I178N	probably damaging	Het
Il17re	T	C	6: 113,469,102	V233A	probably benign	Het
Lemd3	G	A	10: 120,931,958	Q672*	probably null	Het
Myh15	A	G	16: 49,159,978	T1488A	probably benign	Het
Narf	T	A	11: 121,242,626	H84Q	probably benign	Het
Nfil3	G	A	13: 52,968,055	S271F	probably damaging	Het
Npc1	A	G	18: 12,213,299	L280P	possibly damaging	Het
Olfr1181	C	T	2: 88,423,801	V75M	probably damaging	Het
Olfr138	T	A	17: 38,275,626	L285*	probably null	Het
Olfr559	T	A	7: 102,723,600	I297F	possibly damaging	Het
Poli	A	G	18: 70,509,432	S503P	probably benign	Het
Rbm5	T	C	9: 107,765,553	E94G	probably damaging	Het
Robo4	CGG	CG	9: 37,411,490		probably null	Het
Rps6ka5	T	C	12: 100,616,093	I173M	probably damaging	Het
Slc40a1	A	G	1: 45,912,328	L223P	probably damaging	Het
Smg1	T	C	7: 118,206,908	K213E	probably damaging	Het
Spem1	T	A	11: 69,820,937	K300N	probably damaging	Het
Tchh	A	G	3: 93,447,675	E1474G	unknown	Het
Tenm4	A	T	7: 96,894,680	R1968W	probably damaging	Het
Tshz2	A	T	2: 169,884,320	M279L	probably benign	Het
Tuba3a	G	T	6: 125,281,592	T145K	possibly damaging	Het

Other mutations in Nedd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00764:Nedd1	APN	10	92694974	splice site	probably benign
IGL00988:Nedd1	APN	10	92689686	missense	possibly damaging	0.71
IGL01563:Nedd1	APN	10	92698169	critical splice donor site	probably null
IGL01588:Nedd1	APN	10	92686262	missense	probably benign	0.12
IGL01988:Nedd1	APN	10	92714159	missense	probably benign	0.39
IGL02706:Nedd1	APN	10	92686285	missense	possibly damaging	0.88
IGL02938:Nedd1	APN	10	92689657	nonsense	probably null
IGL03011:Nedd1	APN	10	92689641	missense	possibly damaging	0.92
Brainless	UTSW	10	92690773	missense	probably benign	0.01
R0125:Nedd1	UTSW	10	92691929	missense	possibly damaging	0.93
R0173:Nedd1	UTSW	10	92698883	missense	probably benign	0.30
R0244:Nedd1	UTSW	10	92716265	intron	probably benign
R0645:Nedd1	UTSW	10	92691831	splice site	probably null
R0791:Nedd1	UTSW	10	92719614	missense	probably damaging	1.00
R1490:Nedd1	UTSW	10	92700798	missense	probably damaging	1.00
R1522:Nedd1	UTSW	10	92719614	missense	probably damaging	1.00
R1797:Nedd1	UTSW	10	92698739	missense	possibly damaging	0.46
R1984:Nedd1	UTSW	10	92714160	missense	possibly damaging	0.63
R2474:Nedd1	UTSW	10	92719603	missense	probably damaging	0.99
R2877:Nedd1	UTSW	10	92714126	missense	possibly damaging	0.89
R2883:Nedd1	UTSW	10	92694998	missense	probably damaging	0.98
R4694:Nedd1	UTSW	10	92719582	missense	probably benign	0.00
R4798:Nedd1	UTSW	10	92698910	missense	probably benign	0.00
R4830:Nedd1	UTSW	10	92686258	missense	probably damaging	1.00
R4963:Nedd1	UTSW	10	92695031	missense	probably damaging	1.00
R5174:Nedd1	UTSW	10	92711212	missense	possibly damaging	0.77
R5329:Nedd1	UTSW	10	92686240	missense	probably damaging	1.00
R5534:Nedd1	UTSW	10	92695032	missense	probably benign	0.01
R6045:Nedd1	UTSW	10	92695100	nonsense	probably null
R6154:Nedd1	UTSW	10	92698242	missense	possibly damaging	0.65
R6512:Nedd1	UTSW	10	92691875	missense	probably benign
R6692:Nedd1	UTSW	10	92698337	missense	possibly damaging	0.88
R6693:Nedd1	UTSW	10	92698337	missense	possibly damaging	0.88
R6943:Nedd1	UTSW	10	92711306	missense	probably damaging	1.00
R7011:Nedd1	UTSW	10	92690773	missense	probably benign	0.01
R7406:Nedd1	UTSW	10	92711323	splice site	probably null
R7455:Nedd1	UTSW	10	92700925	missense	probably benign	0.01
R7587:Nedd1	UTSW	10	92698730	missense	probably benign	0.01
R7745:Nedd1	UTSW	10	92714172	missense	probably benign
R8104:Nedd1	UTSW	10	92691916	missense	probably damaging	1.00
R8209:Nedd1	UTSW	10	92691935	missense	probably benign
R8226:Nedd1	UTSW	10	92691935	missense	probably benign
R8925:Nedd1	UTSW	10	92722396	start gained	probably benign
R8927:Nedd1	UTSW	10	92722396	start gained	probably benign

Predicted Primers

PCR Primer
(F):5'- GGCCTAAACTGCTCTCCTAAATC -3'
(R):5'- GCTGGTATATGAGCCGCATTTG -3'

Sequencing Primer
(F):5'- TATAATCTCACCTATCAACCTCTCGG -3'
(R):5'- ATATGAGCCGCATTTGTGTACTG -3'

Posted On

2016-09-06