Incidental Mutation 'R5404:Spem1'
ID428636
Institutional Source Beutler Lab
Gene Symbol Spem1
Ensembl Gene ENSMUSG00000041165
Gene Namesperm maturation 1
Synonyms
MMRRC Submission 042975-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.102) question?
Stock #R5404 (G1)
Quality Score214
Status Not validated
Chromosome11
Chromosomal Location69820876-69822180 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 69820937 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 300 (K300N)
Ref Sequence ENSEMBL: ENSMUSP00000037500 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045771] [ENSMUST00000056484] [ENSMUST00000056941] [ENSMUST00000108634]
Predicted Effect probably damaging
Transcript: ENSMUST00000045771
AA Change: K300N

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000037500
Gene: ENSMUSG00000041165
AA Change: K300N

DomainStartEndE-ValueType
Pfam:Spem1 12 196 3.7e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000056484
SMART Domains Protein: ENSMUSP00000053097
Gene: ENSMUSG00000051790

DomainStartEndE-ValueType
Pfam:COesterase 31 601 1.6e-199 PFAM
Pfam:Abhydrolase_3 180 372 4.8e-9 PFAM
low complexity region 630 652 N/A INTRINSIC
transmembrane domain 678 700 N/A INTRINSIC
low complexity region 702 712 N/A INTRINSIC
low complexity region 713 731 N/A INTRINSIC
low complexity region 782 823 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000056941
SMART Domains Protein: ENSMUSP00000051204
Gene: ENSMUSG00000044084

DomainStartEndE-ValueType
Pfam:Spem1 1 261 2e-121 PFAM
low complexity region 281 294 N/A INTRINSIC
low complexity region 478 494 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108634
SMART Domains Protein: ENSMUSP00000104274
Gene: ENSMUSG00000051790

DomainStartEndE-ValueType
Pfam:COesterase 30 601 2e-186 PFAM
Pfam:Abhydrolase_3 180 327 3.3e-9 PFAM
low complexity region 630 652 N/A INTRINSIC
transmembrane domain 678 700 N/A INTRINSIC
low complexity region 702 712 N/A INTRINSIC
low complexity region 713 731 N/A INTRINSIC
low complexity region 782 823 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Male mice homozygous for a null allele display infertility, asthenozoospermia, teratozoospermia, and impaired spermiogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1bg T C 15: 60,919,696 H297R probably benign Het
Ccnk A T 12: 108,195,623 K262N possibly damaging Het
Clec4b2 A T 6: 123,181,349 Y58F probably benign Het
Cp A C 3: 19,989,128 T1027P possibly damaging Het
Cpox G A 16: 58,675,286 G322D probably damaging Het
Cry1 T C 10: 85,184,419 N18S probably damaging Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Dock10 A G 1: 80,503,913 probably benign Het
Fance A T 17: 28,318,060 R58W probably null Het
Fermt1 T C 2: 132,934,869 D233G possibly damaging Het
Gabpa T A 16: 84,860,463 Y409N probably damaging Het
Gpr162 A G 6: 124,861,643 S15P possibly damaging Het
Grid2 T A 6: 63,930,910 I178N probably damaging Het
Il17re T C 6: 113,469,102 V233A probably benign Het
Lemd3 G A 10: 120,931,958 Q672* probably null Het
Myh15 A G 16: 49,159,978 T1488A probably benign Het
Narf T A 11: 121,242,626 H84Q probably benign Het
Nedd1 C T 10: 92,716,192 V69I probably benign Het
Nfil3 G A 13: 52,968,055 S271F probably damaging Het
Npc1 A G 18: 12,213,299 L280P possibly damaging Het
Olfr1181 C T 2: 88,423,801 V75M probably damaging Het
Olfr138 T A 17: 38,275,626 L285* probably null Het
Olfr559 T A 7: 102,723,600 I297F possibly damaging Het
Poli A G 18: 70,509,432 S503P probably benign Het
Rbm5 T C 9: 107,765,553 E94G probably damaging Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Rps6ka5 T C 12: 100,616,093 I173M probably damaging Het
Slc40a1 A G 1: 45,912,328 L223P probably damaging Het
Smg1 T C 7: 118,206,908 K213E probably damaging Het
Tchh A G 3: 93,447,675 E1474G unknown Het
Tenm4 A T 7: 96,894,680 R1968W probably damaging Het
Tshz2 A T 2: 169,884,320 M279L probably benign Het
Tuba3a G T 6: 125,281,592 T145K possibly damaging Het
Other mutations in Spem1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00902:Spem1 APN 11 69821817 missense probably damaging 1.00
R0118:Spem1 UTSW 11 69821545 missense possibly damaging 0.92
R0487:Spem1 UTSW 11 69821865 critical splice acceptor site probably null
R0734:Spem1 UTSW 11 69821271 missense probably damaging 1.00
R2483:Spem1 UTSW 11 69821518 missense possibly damaging 0.95
R4522:Spem1 UTSW 11 69821805 critical splice donor site probably null
R4866:Spem1 UTSW 11 69820929 missense probably damaging 1.00
R5297:Spem1 UTSW 11 69820927 missense probably damaging 1.00
R5672:Spem1 UTSW 11 69821437 missense probably damaging 1.00
R5989:Spem1 UTSW 11 69821125 missense possibly damaging 0.65
R6803:Spem1 UTSW 11 69821148 missense possibly damaging 0.84
R7234:Spem1 UTSW 11 69821804 critical splice donor site probably null
R7631:Spem1 UTSW 11 69821583 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCTAGGAGGGCAAGACATTG -3'
(R):5'- TGTTGAGGGTGAGCAAGCAC -3'

Sequencing Primer
(F):5'- AGACATTGACAAGGGCCCCG -3'
(R):5'- TGAGCAAGCACAGGGCC -3'
Posted On2016-09-06