Incidental Mutation 'R5404:Ccnk'
ID428639
Institutional Source Beutler Lab
Gene Symbol Ccnk
Ensembl Gene ENSMUSG00000021258
Gene Namecyclin K
SynonymsCycK, CPR4
MMRRC Submission 042975-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5404 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location108179579-108203359 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 108195623 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 262 (K262N)
Ref Sequence ENSEMBL: ENSMUSP00000152784 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000101055] [ENSMUST00000221167]
Predicted Effect possibly damaging
Transcript: ENSMUST00000101055
AA Change: K262N

PolyPhen 2 Score 0.879 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000098616
Gene: ENSMUSG00000021258
AA Change: K262N

DomainStartEndE-ValueType
CYCLIN 55 149 6.67e-16 SMART
Cyclin_C 158 278 4.83e-1 SMART
CYCLIN 162 256 1.23e-1 SMART
low complexity region 342 361 N/A INTRINSIC
low complexity region 365 392 N/A INTRINSIC
low complexity region 404 427 N/A INTRINSIC
low complexity region 428 446 N/A INTRINSIC
low complexity region 457 471 N/A INTRINSIC
low complexity region 476 576 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000221167
AA Change: K262N

PolyPhen 2 Score 0.879 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223363
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the transcription cyclin family. These cyclins may regulate transcription through their association with and activation of cyclin-dependent kinases (CDK) that phosphorylate the C-terminal domain (CTD) of the large subunit of RNA polymerase II. This gene product may play a dual role in regulating CDK and RNA polymerase II activities. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele display complete embryonic lethality before implantation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1bg T C 15: 60,919,696 H297R probably benign Het
Clec4b2 A T 6: 123,181,349 Y58F probably benign Het
Cp A C 3: 19,989,128 T1027P possibly damaging Het
Cpox G A 16: 58,675,286 G322D probably damaging Het
Cry1 T C 10: 85,184,419 N18S probably damaging Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Dock10 A G 1: 80,503,913 probably benign Het
Fance A T 17: 28,318,060 R58W probably null Het
Fermt1 T C 2: 132,934,869 D233G possibly damaging Het
Gabpa T A 16: 84,860,463 Y409N probably damaging Het
Gpr162 A G 6: 124,861,643 S15P possibly damaging Het
Grid2 T A 6: 63,930,910 I178N probably damaging Het
Il17re T C 6: 113,469,102 V233A probably benign Het
Lemd3 G A 10: 120,931,958 Q672* probably null Het
Myh15 A G 16: 49,159,978 T1488A probably benign Het
Narf T A 11: 121,242,626 H84Q probably benign Het
Nedd1 C T 10: 92,716,192 V69I probably benign Het
Nfil3 G A 13: 52,968,055 S271F probably damaging Het
Npc1 A G 18: 12,213,299 L280P possibly damaging Het
Olfr1181 C T 2: 88,423,801 V75M probably damaging Het
Olfr138 T A 17: 38,275,626 L285* probably null Het
Olfr559 T A 7: 102,723,600 I297F possibly damaging Het
Poli A G 18: 70,509,432 S503P probably benign Het
Rbm5 T C 9: 107,765,553 E94G probably damaging Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Rps6ka5 T C 12: 100,616,093 I173M probably damaging Het
Slc40a1 A G 1: 45,912,328 L223P probably damaging Het
Smg1 T C 7: 118,206,908 K213E probably damaging Het
Spem1 T A 11: 69,820,937 K300N probably damaging Het
Tchh A G 3: 93,447,675 E1474G unknown Het
Tenm4 A T 7: 96,894,680 R1968W probably damaging Het
Tshz2 A T 2: 169,884,320 M279L probably benign Het
Tuba3a G T 6: 125,281,592 T145K possibly damaging Het
Other mutations in Ccnk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02331:Ccnk APN 12 108189084 missense probably damaging 1.00
IGL02341:Ccnk APN 12 108195730 missense unknown
IGL02557:Ccnk APN 12 108195726 missense unknown
FR4449:Ccnk UTSW 12 108202507 unclassified probably benign
FR4737:Ccnk UTSW 12 108202507 unclassified probably benign
FR4976:Ccnk UTSW 12 108202507 unclassified probably benign
R0481:Ccnk UTSW 12 108199309 unclassified probably benign
R0725:Ccnk UTSW 12 108195575 splice site probably benign
R1839:Ccnk UTSW 12 108195074 missense probably damaging 1.00
R2144:Ccnk UTSW 12 108189090 missense probably null 1.00
R2903:Ccnk UTSW 12 108202388 unclassified probably benign
R4660:Ccnk UTSW 12 108202316 unclassified probably benign
R5131:Ccnk UTSW 12 108202631 unclassified probably benign
R5843:Ccnk UTSW 12 108193730 missense probably damaging 1.00
R5860:Ccnk UTSW 12 108187207 missense probably damaging 0.99
R6522:Ccnk UTSW 12 108187187 missense probably damaging 0.99
R6864:Ccnk UTSW 12 108202214 unclassified probably benign
R7135:Ccnk UTSW 12 108186475 missense probably damaging 0.96
R7179:Ccnk UTSW 12 108187258 missense probably damaging 1.00
R7278:Ccnk UTSW 12 108193705 missense possibly damaging 0.63
R7592:Ccnk UTSW 12 108186465 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- AGAGCCCAGCTTTATTCACAGC -3'
(R):5'- ATGTAAGGCACTCACTCACC -3'

Sequencing Primer
(F):5'- CAGCTTTATTCACAGCAAAAATGGGG -3'
(R):5'- CTTGGCCTGTCGGGGAG -3'
Posted On2016-09-06