Incidental Mutation 'R5404:Nfil3'
ID428640
Institutional Source Beutler Lab
Gene Symbol Nfil3
Ensembl Gene ENSMUSG00000056749
Gene Namenuclear factor, interleukin 3, regulated
SynonymsE4BP4
MMRRC Submission 042975-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5404 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location52967209-52981073 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 52968055 bp
ZygosityHeterozygous
Amino Acid Change Serine to Phenylalanine at position 271 (S271F)
Ref Sequence ENSEMBL: ENSMUSP00000065363 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071065]
Predicted Effect probably damaging
Transcript: ENSMUST00000071065
AA Change: S271F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000065363
Gene: ENSMUSG00000056749
AA Change: S271F

DomainStartEndE-ValueType
BRLZ 71 135 2.84e-5 SMART
low complexity region 182 196 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083837
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is a transcriptional regulator that binds as a homodimer to activating transcription factor (ATF) sites in many cellular and viral promoters. The encoded protein represses Per1 and Per2 expression and therefore plays a role in the regulation of circadian rhythm. [provided by RefSeq, Feb 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased NK cell differentiation, numbers, and activity. Mice homozygous for a different knock-out allele exhibit reduced class switching and IgE production. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1bg T C 15: 60,919,696 H297R probably benign Het
Ccnk A T 12: 108,195,623 K262N possibly damaging Het
Clec4b2 A T 6: 123,181,349 Y58F probably benign Het
Cp A C 3: 19,989,128 T1027P possibly damaging Het
Cpox G A 16: 58,675,286 G322D probably damaging Het
Cry1 T C 10: 85,184,419 N18S probably damaging Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Dock10 A G 1: 80,503,913 probably benign Het
Fance A T 17: 28,318,060 R58W probably null Het
Fermt1 T C 2: 132,934,869 D233G possibly damaging Het
Gabpa T A 16: 84,860,463 Y409N probably damaging Het
Gpr162 A G 6: 124,861,643 S15P possibly damaging Het
Grid2 T A 6: 63,930,910 I178N probably damaging Het
Il17re T C 6: 113,469,102 V233A probably benign Het
Lemd3 G A 10: 120,931,958 Q672* probably null Het
Myh15 A G 16: 49,159,978 T1488A probably benign Het
Narf T A 11: 121,242,626 H84Q probably benign Het
Nedd1 C T 10: 92,716,192 V69I probably benign Het
Npc1 A G 18: 12,213,299 L280P possibly damaging Het
Olfr1181 C T 2: 88,423,801 V75M probably damaging Het
Olfr138 T A 17: 38,275,626 L285* probably null Het
Olfr559 T A 7: 102,723,600 I297F possibly damaging Het
Poli A G 18: 70,509,432 S503P probably benign Het
Rbm5 T C 9: 107,765,553 E94G probably damaging Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Rps6ka5 T C 12: 100,616,093 I173M probably damaging Het
Slc40a1 A G 1: 45,912,328 L223P probably damaging Het
Smg1 T C 7: 118,206,908 K213E probably damaging Het
Spem1 T A 11: 69,820,937 K300N probably damaging Het
Tchh A G 3: 93,447,675 E1474G unknown Het
Tenm4 A T 7: 96,894,680 R1968W probably damaging Het
Tshz2 A T 2: 169,884,320 M279L probably benign Het
Tuba3a G T 6: 125,281,592 T145K possibly damaging Het
Other mutations in Nfil3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00468:Nfil3 APN 13 52967574 missense probably damaging 1.00
IGL01017:Nfil3 APN 13 52968019 missense probably damaging 1.00
IGL02158:Nfil3 APN 13 52968152 missense probably damaging 0.99
luna UTSW 13 52968676 missense probably damaging 1.00
R0140:Nfil3 UTSW 13 52967645 nonsense probably null
R2080:Nfil3 UTSW 13 52968033 missense possibly damaging 0.53
R4235:Nfil3 UTSW 13 52968799 missense probably benign 0.08
R4773:Nfil3 UTSW 13 52968014 missense probably damaging 0.99
R5002:Nfil3 UTSW 13 52968676 missense probably damaging 1.00
R5155:Nfil3 UTSW 13 52968580 missense probably damaging 1.00
R5309:Nfil3 UTSW 13 52967620 missense probably damaging 0.98
R5312:Nfil3 UTSW 13 52967620 missense probably damaging 0.98
R5679:Nfil3 UTSW 13 52968491 missense possibly damaging 0.79
R5855:Nfil3 UTSW 13 52968710 missense probably benign 0.05
R6855:Nfil3 UTSW 13 52968605 nonsense probably null
R7836:Nfil3 UTSW 13 52967932 missense possibly damaging 0.56
R7870:Nfil3 UTSW 13 52968413 missense probably damaging 0.99
R7919:Nfil3 UTSW 13 52967932 missense possibly damaging 0.56
R7953:Nfil3 UTSW 13 52968413 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AACTCGCTGTCCAAAGCCTC -3'
(R):5'- GAGAACAAGTTCCCTGTGATCAAG -3'

Sequencing Primer
(F):5'- CATGGCCTTGGCTTTAATCCGAAG -3'
(R):5'- TTCCCTGTGATCAAGCAGGAG -3'
Posted On2016-09-06