Incidental Mutation 'R5404:Gabpa'
ID428645
Institutional Source Beutler Lab
Gene Symbol Gabpa
Ensembl Gene ENSMUSG00000008976
Gene NameGA repeat binding protein, alpha
SynonymsGABPalpha
MMRRC Submission 042975-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5404 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location84834925-84863779 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 84860463 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 409 (Y409N)
Ref Sequence ENSEMBL: ENSMUSP00000109822 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009120] [ENSMUST00000114184]
Predicted Effect probably damaging
Transcript: ENSMUST00000009120
AA Change: Y409N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000009120
Gene: ENSMUSG00000008976
AA Change: Y409N

DomainStartEndE-ValueType
Pfam:GABP-alpha 34 122 1.6e-45 PFAM
low complexity region 128 141 N/A INTRINSIC
SAM_PNT 170 251 2.99e-40 SMART
ETS 319 404 1.95e-56 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000114184
AA Change: Y409N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109822
Gene: ENSMUSG00000008976
AA Change: Y409N

DomainStartEndE-ValueType
Pfam:GABP-alpha 36 119 4.9e-33 PFAM
low complexity region 128 141 N/A INTRINSIC
SAM_PNT 170 251 2.99e-40 SMART
ETS 319 404 1.95e-56 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126031
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139101
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148035
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of three GA-binding protein transcription factor subunits which functions as a DNA-binding subunit. Since this subunit shares identity with a subunit encoding the nuclear respiratory factor 2 gene, it is likely involved in activation of cytochrome oxidase expression and nuclear control of mitochondrial function. This subunit also shares identity with a subunit constituting the transcription factor E4TF1, responsible for expression of the adenovirus E4 gene. Because of its chromosomal localization and ability to form heterodimers with other polypeptides, this gene may play a role in the Down Syndrome phenotype. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Oct 2010]
PHENOTYPE: Mice homozygous for disruptions in this gene die early in embryonic development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1bg T C 15: 60,919,696 H297R probably benign Het
Ccnk A T 12: 108,195,623 K262N possibly damaging Het
Clec4b2 A T 6: 123,181,349 Y58F probably benign Het
Cp A C 3: 19,989,128 T1027P possibly damaging Het
Cpox G A 16: 58,675,286 G322D probably damaging Het
Cry1 T C 10: 85,184,419 N18S probably damaging Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Dock10 A G 1: 80,503,913 probably benign Het
Fance A T 17: 28,318,060 R58W probably null Het
Fermt1 T C 2: 132,934,869 D233G possibly damaging Het
Gpr162 A G 6: 124,861,643 S15P possibly damaging Het
Grid2 T A 6: 63,930,910 I178N probably damaging Het
Il17re T C 6: 113,469,102 V233A probably benign Het
Lemd3 G A 10: 120,931,958 Q672* probably null Het
Myh15 A G 16: 49,159,978 T1488A probably benign Het
Narf T A 11: 121,242,626 H84Q probably benign Het
Nedd1 C T 10: 92,716,192 V69I probably benign Het
Nfil3 G A 13: 52,968,055 S271F probably damaging Het
Npc1 A G 18: 12,213,299 L280P possibly damaging Het
Olfr1181 C T 2: 88,423,801 V75M probably damaging Het
Olfr138 T A 17: 38,275,626 L285* probably null Het
Olfr559 T A 7: 102,723,600 I297F possibly damaging Het
Poli A G 18: 70,509,432 S503P probably benign Het
Rbm5 T C 9: 107,765,553 E94G probably damaging Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Rps6ka5 T C 12: 100,616,093 I173M probably damaging Het
Slc40a1 A G 1: 45,912,328 L223P probably damaging Het
Smg1 T C 7: 118,206,908 K213E probably damaging Het
Spem1 T A 11: 69,820,937 K300N probably damaging Het
Tchh A G 3: 93,447,675 E1474G unknown Het
Tenm4 A T 7: 96,894,680 R1968W probably damaging Het
Tshz2 A T 2: 169,884,320 M279L probably benign Het
Tuba3a G T 6: 125,281,592 T145K possibly damaging Het
Other mutations in Gabpa
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00519:Gabpa APN 16 84860601 makesense probably null
IGL03075:Gabpa APN 16 84852607 missense possibly damaging 0.82
glacier_bay UTSW 16 84860409 missense possibly damaging 0.84
R0360:Gabpa UTSW 16 84857387 missense possibly damaging 0.84
R0364:Gabpa UTSW 16 84857387 missense possibly damaging 0.84
R1668:Gabpa UTSW 16 84846181 missense probably damaging 0.98
R2415:Gabpa UTSW 16 84844368 critical splice donor site probably null
R4867:Gabpa UTSW 16 84857468 missense probably benign 0.00
R5323:Gabpa UTSW 16 84857046 missense possibly damaging 0.84
R5504:Gabpa UTSW 16 84852558 missense probably benign
R5763:Gabpa UTSW 16 84860409 missense possibly damaging 0.84
R6853:Gabpa UTSW 16 84860499 missense probably damaging 0.99
R6897:Gabpa UTSW 16 84860473 missense probably benign
R7188:Gabpa UTSW 16 84846286 missense probably damaging 0.97
R7432:Gabpa UTSW 16 84857520 nonsense probably null
RF009:Gabpa UTSW 16 84844336 missense probably benign 0.40
X0023:Gabpa UTSW 16 84857529 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCAGAACTCTGCTAGGTTTCTG -3'
(R):5'- TCATGCATCAGATTGTACACTCTAG -3'

Sequencing Primer
(F):5'- CAGAACTCTGCTAGGTTTCTGTTTGC -3'
(R):5'- TTCAGTAATAAAGGTTAGAGCAAAGC -3'
Posted On2016-09-06