Incidental Mutation 'R5404:Olfr138'
ID428648
Institutional Source Beutler Lab
Gene Symbol Olfr138
Ensembl Gene ENSMUSG00000057443
Gene Nameolfactory receptor 138
SynonymsGA_x6K02T2PSCP-2718585-2719523, MOR256-40P, Olfr89
MMRRC Submission 042975-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R5404 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location38261035-38276410 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 38275626 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 285 (L285*)
Ref Sequence ENSEMBL: ENSMUSP00000133828 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071871] [ENSMUST00000172843] [ENSMUST00000173841]
Predicted Effect probably null
Transcript: ENSMUST00000071871
AA Change: L285*
SMART Domains Protein: ENSMUSP00000071767
Gene: ENSMUSG00000057443
AA Change: L285*

DomainStartEndE-ValueType
Pfam:7tm_1 41 290 2.4e-33 PFAM
Pfam:7tm_4 139 283 8.1e-41 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000172843
AA Change: L285*
SMART Domains Protein: ENSMUSP00000133698
Gene: ENSMUSG00000057443
AA Change: L285*

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.5e-46 PFAM
Pfam:7tm_1 41 290 1.9e-23 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000173841
AA Change: L285*
SMART Domains Protein: ENSMUSP00000133828
Gene: ENSMUSG00000057443
AA Change: L285*

DomainStartEndE-ValueType
Pfam:7tm_1 41 123 1.7e-15 PFAM
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1bg T C 15: 60,919,696 H297R probably benign Het
Ccnk A T 12: 108,195,623 K262N possibly damaging Het
Clec4b2 A T 6: 123,181,349 Y58F probably benign Het
Cp A C 3: 19,989,128 T1027P possibly damaging Het
Cpox G A 16: 58,675,286 G322D probably damaging Het
Cry1 T C 10: 85,184,419 N18S probably damaging Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Dock10 A G 1: 80,503,913 probably benign Het
Fance A T 17: 28,318,060 R58W probably null Het
Fermt1 T C 2: 132,934,869 D233G possibly damaging Het
Gabpa T A 16: 84,860,463 Y409N probably damaging Het
Gpr162 A G 6: 124,861,643 S15P possibly damaging Het
Grid2 T A 6: 63,930,910 I178N probably damaging Het
Il17re T C 6: 113,469,102 V233A probably benign Het
Lemd3 G A 10: 120,931,958 Q672* probably null Het
Myh15 A G 16: 49,159,978 T1488A probably benign Het
Narf T A 11: 121,242,626 H84Q probably benign Het
Nedd1 C T 10: 92,716,192 V69I probably benign Het
Nfil3 G A 13: 52,968,055 S271F probably damaging Het
Npc1 A G 18: 12,213,299 L280P possibly damaging Het
Olfr1181 C T 2: 88,423,801 V75M probably damaging Het
Olfr559 T A 7: 102,723,600 I297F possibly damaging Het
Poli A G 18: 70,509,432 S503P probably benign Het
Rbm5 T C 9: 107,765,553 E94G probably damaging Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Rps6ka5 T C 12: 100,616,093 I173M probably damaging Het
Slc40a1 A G 1: 45,912,328 L223P probably damaging Het
Smg1 T C 7: 118,206,908 K213E probably damaging Het
Spem1 T A 11: 69,820,937 K300N probably damaging Het
Tchh A G 3: 93,447,675 E1474G unknown Het
Tenm4 A T 7: 96,894,680 R1968W probably damaging Het
Tshz2 A T 2: 169,884,320 M279L probably benign Het
Tuba3a G T 6: 125,281,592 T145K possibly damaging Het
Other mutations in Olfr138
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00885:Olfr138 APN 17 38274899 missense probably benign 0.01
IGL01874:Olfr138 APN 17 38275517 missense probably benign 0.32
IGL02209:Olfr138 APN 17 38275232 missense probably benign 0.00
IGL03053:Olfr138 APN 17 38274791 missense probably damaging 0.96
IGL03168:Olfr138 APN 17 38274791 missense probably damaging 0.96
R0393:Olfr138 UTSW 17 38274883 missense probably benign 0.00
R0667:Olfr138 UTSW 17 38275157 missense probably damaging 1.00
R1288:Olfr138 UTSW 17 38275223 missense probably benign 0.09
R1567:Olfr138 UTSW 17 38275568 missense possibly damaging 0.87
R1618:Olfr138 UTSW 17 38275666 synonymous probably null
R1699:Olfr138 UTSW 17 38275041 missense probably benign 0.39
R1748:Olfr138 UTSW 17 38275106 missense possibly damaging 0.50
R1862:Olfr138 UTSW 17 38275344 missense probably damaging 0.99
R2251:Olfr138 UTSW 17 38274903 missense probably benign 0.01
R3436:Olfr138 UTSW 17 38275530 missense probably damaging 1.00
R4731:Olfr138 UTSW 17 38275547 missense probably damaging 1.00
R4732:Olfr138 UTSW 17 38275547 missense probably damaging 1.00
R4733:Olfr138 UTSW 17 38275547 missense probably damaging 1.00
R5443:Olfr138 UTSW 17 38275014 missense probably damaging 0.99
R5683:Olfr138 UTSW 17 38275546 missense possibly damaging 0.69
R6058:Olfr138 UTSW 17 38275259 missense probably damaging 0.99
R6061:Olfr138 UTSW 17 38274881 missense probably benign
R6266:Olfr138 UTSW 17 38275148 missense probably benign 0.22
R7520:Olfr138 UTSW 17 38275440 missense probably benign 0.00
R7717:Olfr138 UTSW 17 38275580 missense probably damaging 1.00
X0024:Olfr138 UTSW 17 38275445 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TGAGCTAGCACTTTCTGTGG -3'
(R):5'- TCTCAGAAACGTTTTCAGACTGTTC -3'

Sequencing Primer
(F):5'- GCTTCTTATGTTAATATTGGATGTGC -3'
(R):5'- TTCATAAACATAACCCACACTGTTG -3'
Posted On2016-09-06