Incidental Mutation 'R5405:Erc1'
ID428668
Institutional Source Beutler Lab
Gene Symbol Erc1
Ensembl Gene ENSMUSG00000030172
Gene NameELKS/RAB6-interacting/CAST family member 1
SynonymsB430107L16Rik, Rab6ip2, 5033405M01Rik, RAB6IP2A, 9630025C19Rik, RAB6IP2B
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5405 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location119570796-119848167 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 119824944 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 37 (S37R)
Ref Sequence ENSEMBL: ENSMUSP00000138823 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032279] [ENSMUST00000079582] [ENSMUST00000183703] [ENSMUST00000183880] [ENSMUST00000183911] [ENSMUST00000184838] [ENSMUST00000184864] [ENSMUST00000185139] [ENSMUST00000185143]
Predicted Effect possibly damaging
Transcript: ENSMUST00000032279
AA Change: S37R

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000032279
Gene: ENSMUSG00000030172
AA Change: S37R

DomainStartEndE-ValueType
low complexity region 13 34 N/A INTRINSIC
low complexity region 35 51 N/A INTRINSIC
Pfam:Cast 154 466 1.8e-142 PFAM
Pfam:Cast 453 838 3.5e-163 PFAM
Pfam:Cast 833 986 8e-61 PFAM
Pfam:RBD-FIP 1072 1112 1.5e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000079582
SMART Domains Protein: ENSMUSP00000078534
Gene: ENSMUSG00000030172

DomainStartEndE-ValueType
Pfam:Cast 3 349 8.9e-149 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000183703
AA Change: S37R

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000139031
Gene: ENSMUSG00000030172
AA Change: S37R

DomainStartEndE-ValueType
low complexity region 13 34 N/A INTRINSIC
low complexity region 35 51 N/A INTRINSIC
Pfam:Cast 154 986 6.9e-291 PFAM
Pfam:RBD-FIP 1072 1112 1.5e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183741
Predicted Effect probably damaging
Transcript: ENSMUST00000183880
AA Change: S37R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000138823
Gene: ENSMUSG00000030172
AA Change: S37R

DomainStartEndE-ValueType
low complexity region 13 34 N/A INTRINSIC
low complexity region 35 51 N/A INTRINSIC
Pfam:Cast 154 914 4.3e-296 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000183911
AA Change: S37R

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000139118
Gene: ENSMUSG00000030172
AA Change: S37R

DomainStartEndE-ValueType
low complexity region 13 34 N/A INTRINSIC
low complexity region 35 51 N/A INTRINSIC
Pfam:Cast 154 954 4.2e-293 PFAM
Pfam:RBD-FIP 1040 1080 8.5e-14 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000184838
AA Change: S37R

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000139030
Gene: ENSMUSG00000030172
AA Change: S37R

DomainStartEndE-ValueType
low complexity region 13 34 N/A INTRINSIC
low complexity region 35 51 N/A INTRINSIC
Pfam:Cast 154 942 3.5e-291 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000184864
AA Change: S37R

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000139256
Gene: ENSMUSG00000030172
AA Change: S37R

DomainStartEndE-ValueType
low complexity region 13 34 N/A INTRINSIC
low complexity region 35 51 N/A INTRINSIC
Pfam:Cast 154 982 2e-288 PFAM
Pfam:RBD-FIP 1068 1108 8.7e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000185139
AA Change: S37R

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000139152
Gene: ENSMUSG00000030172
AA Change: S37R

DomainStartEndE-ValueType
low complexity region 13 34 N/A INTRINSIC
low complexity region 35 51 N/A INTRINSIC
Pfam:Cast 154 958 3.6e-295 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000185143
AA Change: S37R
SMART Domains Protein: ENSMUSP00000138989
Gene: ENSMUSG00000030172
AA Change: S37R

DomainStartEndE-ValueType
low complexity region 13 34 N/A INTRINSIC
low complexity region 35 51 N/A INTRINSIC
Pfam:Cast 154 224 1.7e-28 PFAM
Pfam:Cast 222 686 8e-145 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of a family of RIM-binding proteins. RIMs are active zone proteins that regulate neurotransmitter release. This gene has been found fused to the receptor-type tyrosine kinase gene RET by gene rearrangement due to the translocation t(10;12)(q11;p13) in thyroid papillary carcinoma. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for null mutations in this gene display embryonic lethality. Mice heterozygous for a gene trap null allele exhibit increased sensitivity to ionizing radiation-induced lethality, with males being more affected than females. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik A G 2: 130,712,460 S890P probably damaging Het
5330417C22Rik A T 3: 108,467,786 C588* probably null Het
Add2 A T 6: 86,101,197 T298S probably benign Het
Atad2b G A 12: 4,940,098 R141Q possibly damaging Het
B3glct A G 5: 149,709,353 Q56R probably damaging Het
Cdc42bpa A G 1: 180,138,520 E1136G possibly damaging Het
Cdc42bpa A G 1: 180,067,329 Y358C probably damaging Het
Ceacam1 A T 7: 25,463,865 N314K probably benign Het
Ces1g A T 8: 93,305,868 I488N probably benign Het
Chd6 C T 2: 160,965,390 R1968K probably benign Het
Cyp27b1 C T 10: 127,050,386 T312I possibly damaging Het
Cyp39a1 C T 17: 43,676,940 A99V probably damaging Het
Fam69a C T 5: 107,909,961 V199I probably benign Het
Gm10801 TC TCGAC 2: 98,663,806 probably benign Het
Gm11639 A T 11: 104,721,192 D620V probably benign Het
Gm14443 T C 2: 175,171,851 I43V possibly damaging Het
Ins2 C T 7: 142,679,397 R46H probably damaging Het
Krt77 T C 15: 101,861,088 I413V probably damaging Het
Lpin3 A G 2: 160,903,929 D660G probably damaging Het
Mpp3 T C 11: 102,010,221 Q318R probably benign Het
Mpzl2 T C 9: 45,047,205 S80P probably damaging Het
Mrpl2 T C 17: 46,649,110 probably null Het
Mrpl48 T C 7: 100,559,793 Y108C probably damaging Het
Ndufaf7 C A 17: 78,938,615 F92L probably damaging Het
Olfr299 T C 7: 86,466,175 Y255H probably damaging Het
Olfr767 T A 10: 129,079,396 D189V probably damaging Het
Pqlc3 A G 12: 16,993,314 probably benign Het
Rec114 T C 9: 58,660,341 S121G probably benign Het
Rnase10 A T 14: 51,009,860 I195F probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rreb1 A G 13: 37,949,111 E1754G probably damaging Het
Sec31a G T 5: 100,383,798 C238* probably null Het
Slc12a6 T C 2: 112,339,379 V337A probably damaging Het
Slc25a37 A G 14: 69,244,895 V319A possibly damaging Het
Slc26a10 T C 10: 127,174,995 Y456C probably benign Het
Slc27a3 G A 3: 90,387,075 T463I probably benign Het
Stard9 T A 2: 120,693,668 D781E probably benign Het
Tle1 T C 4: 72,138,971 probably benign Het
Tmem229b-ps T C 10: 53,475,229 noncoding transcript Het
Vmn2r114 ATTT ATT 17: 23,290,932 probably null Het
Vmn2r71 A G 7: 85,619,414 D275G probably benign Het
Wdr1 T C 5: 38,535,200 T121A probably benign Het
Zdhhc19 C T 16: 32,507,051 R240C possibly damaging Het
Other mutations in Erc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01302:Erc1 APN 6 119722303 missense probably damaging 0.96
IGL01345:Erc1 APN 6 119761263 nonsense probably null
IGL01370:Erc1 APN 6 119824465 missense probably damaging 1.00
IGL01443:Erc1 APN 6 119824471 missense probably damaging 1.00
IGL01550:Erc1 APN 6 119783394 missense probably damaging 0.96
IGL01798:Erc1 APN 6 119620337 missense possibly damaging 0.86
IGL02032:Erc1 APN 6 119630609 missense probably damaging 1.00
IGL02239:Erc1 APN 6 119773891 missense probably damaging 0.96
IGL02341:Erc1 APN 6 119594973 missense possibly damaging 0.92
couch UTSW 6 119743429 missense possibly damaging 0.81
divan UTSW 6 119753288 missense probably benign 0.27
PIT4498001:Erc1 UTSW 6 119779491 missense possibly damaging 0.92
R0149:Erc1 UTSW 6 119824830 missense probably damaging 1.00
R0277:Erc1 UTSW 6 119620328 missense probably damaging 1.00
R0323:Erc1 UTSW 6 119620328 missense probably damaging 1.00
R1053:Erc1 UTSW 6 119796926 missense probably damaging 1.00
R1252:Erc1 UTSW 6 119743392 missense possibly damaging 0.84
R1355:Erc1 UTSW 6 119743420 nonsense probably null
R1470:Erc1 UTSW 6 119694602 missense probably damaging 1.00
R1470:Erc1 UTSW 6 119694602 missense probably damaging 1.00
R1680:Erc1 UTSW 6 119575761 missense probably damaging 1.00
R1833:Erc1 UTSW 6 119743429 missense possibly damaging 0.81
R1954:Erc1 UTSW 6 119797305 missense probably damaging 1.00
R2037:Erc1 UTSW 6 119722255 missense possibly damaging 0.94
R2365:Erc1 UTSW 6 119575695 missense probably damaging 1.00
R3751:Erc1 UTSW 6 119824960 missense probably damaging 0.99
R4473:Erc1 UTSW 6 119848456 splice site probably null
R4778:Erc1 UTSW 6 119797337 splice site probably null
R4897:Erc1 UTSW 6 119777986 critical splice donor site probably null
R5260:Erc1 UTSW 6 119761159 missense probably damaging 1.00
R5382:Erc1 UTSW 6 119761272 missense probably benign 0.02
R5801:Erc1 UTSW 6 119773822 missense probably damaging 0.99
R6341:Erc1 UTSW 6 119777998 missense possibly damaging 0.94
R6588:Erc1 UTSW 6 119575726 missense possibly damaging 0.92
R7441:Erc1 UTSW 6 119824951 missense possibly damaging 0.86
R7486:Erc1 UTSW 6 119594946 nonsense probably null
R7532:Erc1 UTSW 6 119779631 missense probably benign 0.02
R7575:Erc1 UTSW 6 119824760 missense possibly damaging 0.93
R7576:Erc1 UTSW 6 119824760 missense possibly damaging 0.93
R7705:Erc1 UTSW 6 119824603 missense probably benign 0.33
R7740:Erc1 UTSW 6 119761188 missense probably benign 0.02
R7789:Erc1 UTSW 6 119773709 nonsense probably null
R7805:Erc1 UTSW 6 119713771 missense possibly damaging 0.85
R7833:Erc1 UTSW 6 119824486 nonsense probably null
R8039:Erc1 UTSW 6 119773665 nonsense probably null
R8229:Erc1 UTSW 6 119753288 missense probably benign 0.27
R8363:Erc1 UTSW 6 119753299 missense probably benign 0.00
R8794:Erc1 UTSW 6 119630655 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CAGAACGGCCAAGTGTCATG -3'
(R):5'- GCTGGCCTGCTACTTCTGTTAG -3'

Sequencing Primer
(F):5'- CCAAGTGTCATGGTGCTTTTAG -3'
(R):5'- GCTGTAAGCTGACTTTATAGCCATAG -3'
Posted On2016-09-06