Incidental Mutation 'R5405:Ces1g'
ID428674
Institutional Source Beutler Lab
Gene Symbol Ces1g
Ensembl Gene ENSMUSG00000057074
Gene Namecarboxylesterase 1G
SynonymsSes-1, Ces1, Ces-1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R5405 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location93302369-93337308 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 93305868 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 488 (I488N)
Ref Sequence ENSEMBL: ENSMUSP00000037555 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044602]
Predicted Effect probably benign
Transcript: ENSMUST00000044602
AA Change: I488N

PolyPhen 2 Score 0.289 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000037555
Gene: ENSMUSG00000057074
AA Change: I488N

DomainStartEndE-ValueType
Pfam:COesterase 1 545 3.6e-168 PFAM
Pfam:Abhydrolase_3 136 295 5.7e-11 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the carboxylesterase large family. The family members are responsible for the hydrolysis or transesterification of various xenobiotics, such as cocaine and heroin, and endogenous substrates with ester, thioester, or amide bonds. They may participate in fatty acyl and cholesterol ester metabolism, and may play a role in the blood-brain barrier system. This enzyme is the major liver enzyme and functions in liver drug clearance. The expression and activity of this gene is age-related but independent of growth hormone level. This gene is clustered with Ces7 and Ces3 on chromosome 8. [provided by RefSeq, Jun 2010]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik A G 2: 130,712,460 S890P probably damaging Het
5330417C22Rik A T 3: 108,467,786 C588* probably null Het
Add2 A T 6: 86,101,197 T298S probably benign Het
Atad2b G A 12: 4,940,098 R141Q possibly damaging Het
B3glct A G 5: 149,709,353 Q56R probably damaging Het
Cdc42bpa A G 1: 180,067,329 Y358C probably damaging Het
Cdc42bpa A G 1: 180,138,520 E1136G possibly damaging Het
Ceacam1 A T 7: 25,463,865 N314K probably benign Het
Chd6 C T 2: 160,965,390 R1968K probably benign Het
Cyp27b1 C T 10: 127,050,386 T312I possibly damaging Het
Cyp39a1 C T 17: 43,676,940 A99V probably damaging Het
Erc1 A T 6: 119,824,944 S37R probably damaging Het
Fam69a C T 5: 107,909,961 V199I probably benign Het
Gm10801 TC TCGAC 2: 98,663,806 probably benign Het
Gm11639 A T 11: 104,721,192 D620V probably benign Het
Gm14443 T C 2: 175,171,851 I43V possibly damaging Het
Ins2 C T 7: 142,679,397 R46H probably damaging Het
Krt77 T C 15: 101,861,088 I413V probably damaging Het
Lpin3 A G 2: 160,903,929 D660G probably damaging Het
Mpp3 T C 11: 102,010,221 Q318R probably benign Het
Mpzl2 T C 9: 45,047,205 S80P probably damaging Het
Mrpl2 T C 17: 46,649,110 probably null Het
Mrpl48 T C 7: 100,559,793 Y108C probably damaging Het
Ndufaf7 C A 17: 78,938,615 F92L probably damaging Het
Olfr299 T C 7: 86,466,175 Y255H probably damaging Het
Olfr767 T A 10: 129,079,396 D189V probably damaging Het
Pqlc3 A G 12: 16,993,314 probably benign Het
Rec114 T C 9: 58,660,341 S121G probably benign Het
Rnase10 A T 14: 51,009,860 I195F probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rreb1 A G 13: 37,949,111 E1754G probably damaging Het
Sec31a G T 5: 100,383,798 C238* probably null Het
Slc12a6 T C 2: 112,339,379 V337A probably damaging Het
Slc25a37 A G 14: 69,244,895 V319A possibly damaging Het
Slc26a10 T C 10: 127,174,995 Y456C probably benign Het
Slc27a3 G A 3: 90,387,075 T463I probably benign Het
Stard9 T A 2: 120,693,668 D781E probably benign Het
Tle1 T C 4: 72,138,971 probably benign Het
Tmem229b-ps T C 10: 53,475,229 noncoding transcript Het
Vmn2r114 ATTT ATT 17: 23,290,932 probably null Het
Vmn2r71 A G 7: 85,619,414 D275G probably benign Het
Wdr1 T C 5: 38,535,200 T121A probably benign Het
Zdhhc19 C T 16: 32,507,051 R240C possibly damaging Het
Other mutations in Ces1g
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00841:Ces1g APN 8 93302987 missense possibly damaging 0.61
IGL00971:Ces1g APN 8 93303032 missense probably damaging 1.00
IGL01583:Ces1g APN 8 93306959 missense probably damaging 1.00
IGL02993:Ces1g APN 8 93317079 missense probably benign 0.00
IGL03386:Ces1g APN 8 93325812 missense probably benign 0.00
R0359:Ces1g UTSW 8 93328535 splice site probably benign
R0373:Ces1g UTSW 8 93331193 missense probably benign 0.06
R0499:Ces1g UTSW 8 93333689 missense probably benign 0.01
R0689:Ces1g UTSW 8 93328407 missense probably damaging 1.00
R1756:Ces1g UTSW 8 93306954 missense probably benign 0.03
R3052:Ces1g UTSW 8 93335048 missense possibly damaging 0.50
R3150:Ces1g UTSW 8 93325816 missense probably benign 0.45
R3899:Ces1g UTSW 8 93303050 missense probably damaging 1.00
R3966:Ces1g UTSW 8 93328511 missense possibly damaging 0.50
R4134:Ces1g UTSW 8 93319872 missense probably benign 0.00
R4198:Ces1g UTSW 8 93305868 missense probably benign 0.11
R4332:Ces1g UTSW 8 93319818 missense probably benign 0.01
R4719:Ces1g UTSW 8 93317090 missense possibly damaging 0.59
R4841:Ces1g UTSW 8 93333695 missense probably benign 0.01
R4842:Ces1g UTSW 8 93333695 missense probably benign 0.01
R4843:Ces1g UTSW 8 93331265 missense probably damaging 1.00
R5344:Ces1g UTSW 8 93337193 start gained probably benign
R5425:Ces1g UTSW 8 93325800 missense probably benign 0.20
R5884:Ces1g UTSW 8 93306930 missense probably benign 0.24
R6022:Ces1g UTSW 8 93328457 missense probably damaging 1.00
R6183:Ces1g UTSW 8 93331239 missense possibly damaging 0.48
R6197:Ces1g UTSW 8 93337136 missense probably benign 0.01
R6307:Ces1g UTSW 8 93331192 missense possibly damaging 0.60
R6688:Ces1g UTSW 8 93306972 missense possibly damaging 0.92
R6863:Ces1g UTSW 8 93317019 missense possibly damaging 0.92
R7097:Ces1g UTSW 8 93317037 missense possibly damaging 0.89
R7122:Ces1g UTSW 8 93317037 missense possibly damaging 0.89
R7180:Ces1g UTSW 8 93302948 missense probably benign 0.04
R7202:Ces1g UTSW 8 93302967 missense probably benign 0.01
R7361:Ces1g UTSW 8 93333679 missense not run
R7537:Ces1g UTSW 8 93319827 missense probably benign 0.01
R7621:Ces1g UTSW 8 93328466 missense probably damaging 1.00
R8200:Ces1g UTSW 8 93328457 missense probably damaging 1.00
R8895:Ces1g UTSW 8 93319884 missense possibly damaging 0.83
Z1176:Ces1g UTSW 8 93325811 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CATTGTGAGAATGCTATAGTCAGAGG -3'
(R):5'- GCCAAAAGTGCATTTATCCCC -3'

Sequencing Primer
(F):5'- GGACAGGAGGACAATCACTC -3'
(R):5'- CCCCTTCAAATAGTAACCAGGTTTG -3'
Posted On2016-09-06