Incidental Mutation 'R5405:Slc26a10'
ID428679
Institutional Source Beutler Lab
Gene Symbol Slc26a10
Ensembl Gene ENSMUSG00000040441
Gene Namesolute carrier family 26, member 10
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5405 (G1)
Quality Score200
Status Not validated
Chromosome10
Chromosomal Location127171393-127180645 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 127174995 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 456 (Y456C)
Ref Sequence ENSEMBL: ENSMUSP00000092904 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006914] [ENSMUST00000095270] [ENSMUST00000217678] [ENSMUST00000222911]
Predicted Effect probably benign
Transcript: ENSMUST00000006914
SMART Domains Protein: ENSMUSP00000006914
Gene: ENSMUSG00000006731

DomainStartEndE-ValueType
transmembrane domain 7 24 N/A INTRINSIC
low complexity region 191 202 N/A INTRINSIC
Pfam:Glycos_transf_2 280 450 7e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000095270
AA Change: Y456C

PolyPhen 2 Score 0.086 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000092904
Gene: ENSMUSG00000040441
AA Change: Y456C

DomainStartEndE-ValueType
low complexity region 51 78 N/A INTRINSIC
low complexity region 82 97 N/A INTRINSIC
Pfam:Sulfate_transp 105 497 5.5e-103 PFAM
low complexity region 512 522 N/A INTRINSIC
Pfam:STAS 549 664 3.3e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000217678
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218658
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218977
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220327
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221174
Predicted Effect probably benign
Transcript: ENSMUST00000222911
AA Change: Y448C

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik A G 2: 130,712,460 S890P probably damaging Het
5330417C22Rik A T 3: 108,467,786 C588* probably null Het
Add2 A T 6: 86,101,197 T298S probably benign Het
Atad2b G A 12: 4,940,098 R141Q possibly damaging Het
B3glct A G 5: 149,709,353 Q56R probably damaging Het
Cdc42bpa A G 1: 180,067,329 Y358C probably damaging Het
Cdc42bpa A G 1: 180,138,520 E1136G possibly damaging Het
Ceacam1 A T 7: 25,463,865 N314K probably benign Het
Ces1g A T 8: 93,305,868 I488N probably benign Het
Chd6 C T 2: 160,965,390 R1968K probably benign Het
Cyp27b1 C T 10: 127,050,386 T312I possibly damaging Het
Cyp39a1 C T 17: 43,676,940 A99V probably damaging Het
Erc1 A T 6: 119,824,944 S37R probably damaging Het
Fam69a C T 5: 107,909,961 V199I probably benign Het
Gm10801 TC TCGAC 2: 98,663,806 probably benign Het
Gm11639 A T 11: 104,721,192 D620V probably benign Het
Gm14443 T C 2: 175,171,851 I43V possibly damaging Het
Ins2 C T 7: 142,679,397 R46H probably damaging Het
Krt77 T C 15: 101,861,088 I413V probably damaging Het
Lpin3 A G 2: 160,903,929 D660G probably damaging Het
Mpp3 T C 11: 102,010,221 Q318R probably benign Het
Mpzl2 T C 9: 45,047,205 S80P probably damaging Het
Mrpl2 T C 17: 46,649,110 probably null Het
Mrpl48 T C 7: 100,559,793 Y108C probably damaging Het
Ndufaf7 C A 17: 78,938,615 F92L probably damaging Het
Olfr299 T C 7: 86,466,175 Y255H probably damaging Het
Olfr767 T A 10: 129,079,396 D189V probably damaging Het
Pqlc3 A G 12: 16,993,314 probably benign Het
Rec114 T C 9: 58,660,341 S121G probably benign Het
Rnase10 A T 14: 51,009,860 I195F probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rreb1 A G 13: 37,949,111 E1754G probably damaging Het
Sec31a G T 5: 100,383,798 C238* probably null Het
Slc12a6 T C 2: 112,339,379 V337A probably damaging Het
Slc25a37 A G 14: 69,244,895 V319A possibly damaging Het
Slc27a3 G A 3: 90,387,075 T463I probably benign Het
Stard9 T A 2: 120,693,668 D781E probably benign Het
Tle1 T C 4: 72,138,971 probably benign Het
Tmem229b-ps T C 10: 53,475,229 noncoding transcript Het
Vmn2r114 ATTT ATT 17: 23,290,932 probably null Het
Vmn2r71 A G 7: 85,619,414 D275G probably benign Het
Wdr1 T C 5: 38,535,200 T121A probably benign Het
Zdhhc19 C T 16: 32,507,051 R240C possibly damaging Het
Other mutations in Slc26a10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01149:Slc26a10 APN 10 127174177 splice site probably benign
IGL01657:Slc26a10 APN 10 127175034 missense probably damaging 1.00
R1202:Slc26a10 UTSW 10 127173348 missense probably damaging 0.99
R1844:Slc26a10 UTSW 10 127178410 missense probably damaging 0.97
R2423:Slc26a10 UTSW 10 127179737 critical splice acceptor site probably null
R4031:Slc26a10 UTSW 10 127178002 missense possibly damaging 0.57
R4779:Slc26a10 UTSW 10 127173355 missense possibly damaging 0.73
R5478:Slc26a10 UTSW 10 127173949 missense probably benign 0.05
R5657:Slc26a10 UTSW 10 127174964 intron probably benign
R5990:Slc26a10 UTSW 10 127178758 missense possibly damaging 0.81
R6681:Slc26a10 UTSW 10 127173661 missense possibly damaging 0.93
R7083:Slc26a10 UTSW 10 127177168 missense probably damaging 1.00
R7365:Slc26a10 UTSW 10 127176847 missense possibly damaging 0.95
R7997:Slc26a10 UTSW 10 127173309 missense possibly damaging 0.93
R8211:Slc26a10 UTSW 10 127173965 missense probably benign 0.06
R8268:Slc26a10 UTSW 10 127173622 critical splice donor site probably null
R8906:Slc26a10 UTSW 10 127180590 missense probably benign 0.02
Z1177:Slc26a10 UTSW 10 127179658 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- AGAGCTGCGGAAGTTCTTGC -3'
(R):5'- GTGTGATTGGCAGAACATCAAG -3'

Sequencing Primer
(F):5'- CTTGCATCTGGAAGAACATCTGGC -3'
(R):5'- TTGGCAGAACATCAAGAACGG -3'
Posted On2016-09-06