Incidental Mutation 'R5405:Olfr767'
ID428680
Institutional Source Beutler Lab
Gene Symbol Olfr767
Ensembl Gene ENSMUSG00000059762
Gene Nameolfactory receptor 767
SynonymsMOR115-1, GA_x6K02T2PULF-10765431-10764502
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R5405 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location129074825-129082910 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 129079396 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 189 (D189V)
Ref Sequence ENSEMBL: ENSMUSP00000150151 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082131] [ENSMUST00000213579]
Predicted Effect probably damaging
Transcript: ENSMUST00000082131
AA Change: D189V

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000080775
Gene: ENSMUSG00000059762
AA Change: D189V

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 1.9e-49 PFAM
Pfam:7tm_1 39 288 3.6e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213579
AA Change: D189V

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik A G 2: 130,712,460 S890P probably damaging Het
5330417C22Rik A T 3: 108,467,786 C588* probably null Het
Add2 A T 6: 86,101,197 T298S probably benign Het
Atad2b G A 12: 4,940,098 R141Q possibly damaging Het
B3glct A G 5: 149,709,353 Q56R probably damaging Het
Cdc42bpa A G 1: 180,067,329 Y358C probably damaging Het
Cdc42bpa A G 1: 180,138,520 E1136G possibly damaging Het
Ceacam1 A T 7: 25,463,865 N314K probably benign Het
Ces1g A T 8: 93,305,868 I488N probably benign Het
Chd6 C T 2: 160,965,390 R1968K probably benign Het
Cyp27b1 C T 10: 127,050,386 T312I possibly damaging Het
Cyp39a1 C T 17: 43,676,940 A99V probably damaging Het
Erc1 A T 6: 119,824,944 S37R probably damaging Het
Fam69a C T 5: 107,909,961 V199I probably benign Het
Gm10801 TC TCGAC 2: 98,663,806 probably benign Het
Gm11639 A T 11: 104,721,192 D620V probably benign Het
Gm14443 T C 2: 175,171,851 I43V possibly damaging Het
Ins2 C T 7: 142,679,397 R46H probably damaging Het
Krt77 T C 15: 101,861,088 I413V probably damaging Het
Lpin3 A G 2: 160,903,929 D660G probably damaging Het
Mpp3 T C 11: 102,010,221 Q318R probably benign Het
Mpzl2 T C 9: 45,047,205 S80P probably damaging Het
Mrpl2 T C 17: 46,649,110 probably null Het
Mrpl48 T C 7: 100,559,793 Y108C probably damaging Het
Ndufaf7 C A 17: 78,938,615 F92L probably damaging Het
Olfr299 T C 7: 86,466,175 Y255H probably damaging Het
Pqlc3 A G 12: 16,993,314 probably benign Het
Rec114 T C 9: 58,660,341 S121G probably benign Het
Rnase10 A T 14: 51,009,860 I195F probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rreb1 A G 13: 37,949,111 E1754G probably damaging Het
Sec31a G T 5: 100,383,798 C238* probably null Het
Slc12a6 T C 2: 112,339,379 V337A probably damaging Het
Slc25a37 A G 14: 69,244,895 V319A possibly damaging Het
Slc26a10 T C 10: 127,174,995 Y456C probably benign Het
Slc27a3 G A 3: 90,387,075 T463I probably benign Het
Stard9 T A 2: 120,693,668 D781E probably benign Het
Tle1 T C 4: 72,138,971 probably benign Het
Tmem229b-ps T C 10: 53,475,229 noncoding transcript Het
Vmn2r114 ATTT ATT 17: 23,290,932 probably null Het
Vmn2r71 A G 7: 85,619,414 D275G probably benign Het
Wdr1 T C 5: 38,535,200 T121A probably benign Het
Zdhhc19 C T 16: 32,507,051 R240C possibly damaging Het
Other mutations in Olfr767
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01784:Olfr767 APN 10 129079355 missense probably benign 0.13
IGL01945:Olfr767 APN 10 129079303 missense probably damaging 1.00
IGL02341:Olfr767 APN 10 129079461 nonsense probably null
IGL02389:Olfr767 APN 10 129079230 missense probably damaging 0.97
IGL02516:Olfr767 APN 10 129079793 missense possibly damaging 0.95
IGL02755:Olfr767 APN 10 129079196 missense probably benign 0.00
R0145:Olfr767 UTSW 10 129079363 missense probably damaging 0.97
R0453:Olfr767 UTSW 10 129079771 missense probably damaging 0.97
R0578:Olfr767 UTSW 10 129079193 missense probably damaging 1.00
R1034:Olfr767 UTSW 10 129079961 start codon destroyed probably benign 0.43
R1494:Olfr767 UTSW 10 129079615 missense probably damaging 1.00
R1941:Olfr767 UTSW 10 129079954 missense probably damaging 0.99
R3707:Olfr767 UTSW 10 129079385 missense probably benign 0.31
R5716:Olfr767 UTSW 10 129079555 missense probably benign 0.00
Z1177:Olfr767 UTSW 10 129080052
Predicted Primers PCR Primer
(F):5'- AGCAGCTCCCATAAGAGAGG -3'
(R):5'- CTATGTGGCCATATGCAAACC -3'

Sequencing Primer
(F):5'- CTCCCATAAGAGAGGGAGATGAC -3'
(R):5'- CCCCTGCACTACATGGC -3'
Posted On2016-09-06