Incidental Mutation 'R5405:Rnase10'
ID428687
Institutional Source Beutler Lab
Gene Symbol Rnase10
Ensembl Gene ENSMUSG00000021872
Gene Nameribonuclease, RNase A family, 10 (non-active)
Synonyms4930474F22Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5405 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location51007751-51010758 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 51009860 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 195 (I195F)
Ref Sequence ENSEMBL: ENSMUSP00000131065 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022424] [ENSMUST00000164632]
Predicted Effect probably damaging
Transcript: ENSMUST00000022424
AA Change: I232F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022424
Gene: ENSMUSG00000021872
AA Change: I232F

DomainStartEndE-ValueType
transmembrane domain 40 62 N/A INTRINSIC
low complexity region 87 98 N/A INTRINSIC
Pfam:RnaseA 132 244 2.2e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000164632
AA Change: I195F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131065
Gene: ENSMUSG00000021872
AA Change: I195F

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 50 61 N/A INTRINSIC
Pfam:RnaseA 91 208 1.4e-21 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous disruption of this gene leads to decreased bone mineral density, alterations in B cell, T cell and NK cell number, and abnormal circulating glucose, creatinine, chloride and serum albumin levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik A G 2: 130,712,460 S890P probably damaging Het
5330417C22Rik A T 3: 108,467,786 C588* probably null Het
Add2 A T 6: 86,101,197 T298S probably benign Het
Atad2b G A 12: 4,940,098 R141Q possibly damaging Het
B3glct A G 5: 149,709,353 Q56R probably damaging Het
Cdc42bpa A G 1: 180,067,329 Y358C probably damaging Het
Cdc42bpa A G 1: 180,138,520 E1136G possibly damaging Het
Ceacam1 A T 7: 25,463,865 N314K probably benign Het
Ces1g A T 8: 93,305,868 I488N probably benign Het
Chd6 C T 2: 160,965,390 R1968K probably benign Het
Cyp27b1 C T 10: 127,050,386 T312I possibly damaging Het
Cyp39a1 C T 17: 43,676,940 A99V probably damaging Het
Erc1 A T 6: 119,824,944 S37R probably damaging Het
Fam69a C T 5: 107,909,961 V199I probably benign Het
Gm10801 TC TCGAC 2: 98,663,806 probably benign Het
Gm11639 A T 11: 104,721,192 D620V probably benign Het
Gm14443 T C 2: 175,171,851 I43V possibly damaging Het
Ins2 C T 7: 142,679,397 R46H probably damaging Het
Krt77 T C 15: 101,861,088 I413V probably damaging Het
Lpin3 A G 2: 160,903,929 D660G probably damaging Het
Mpp3 T C 11: 102,010,221 Q318R probably benign Het
Mpzl2 T C 9: 45,047,205 S80P probably damaging Het
Mrpl2 T C 17: 46,649,110 probably null Het
Mrpl48 T C 7: 100,559,793 Y108C probably damaging Het
Ndufaf7 C A 17: 78,938,615 F92L probably damaging Het
Olfr299 T C 7: 86,466,175 Y255H probably damaging Het
Olfr767 T A 10: 129,079,396 D189V probably damaging Het
Pqlc3 A G 12: 16,993,314 probably benign Het
Rec114 T C 9: 58,660,341 S121G probably benign Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rreb1 A G 13: 37,949,111 E1754G probably damaging Het
Sec31a G T 5: 100,383,798 C238* probably null Het
Slc12a6 T C 2: 112,339,379 V337A probably damaging Het
Slc25a37 A G 14: 69,244,895 V319A possibly damaging Het
Slc26a10 T C 10: 127,174,995 Y456C probably benign Het
Slc27a3 G A 3: 90,387,075 T463I probably benign Het
Stard9 T A 2: 120,693,668 D781E probably benign Het
Tle1 T C 4: 72,138,971 probably benign Het
Tmem229b-ps T C 10: 53,475,229 noncoding transcript Het
Vmn2r114 ATTT ATT 17: 23,290,932 probably null Het
Vmn2r71 A G 7: 85,619,414 D275G probably benign Het
Wdr1 T C 5: 38,535,200 T121A probably benign Het
Zdhhc19 C T 16: 32,507,051 R240C possibly damaging Het
Other mutations in Rnase10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Rnase10 APN 14 51009781 missense possibly damaging 0.91
IGL01534:Rnase10 APN 14 51007979 missense probably benign 0.00
IGL02082:Rnase10 APN 14 51009399 missense probably damaging 1.00
IGL02661:Rnase10 APN 14 51009816 missense probably damaging 1.00
R1254:Rnase10 UTSW 14 51009626 missense probably damaging 0.99
R1989:Rnase10 UTSW 14 51009638 missense probably benign 0.03
R3878:Rnase10 UTSW 14 51009432 missense probably damaging 0.97
R5942:Rnase10 UTSW 14 51009278 missense probably benign 0.08
R6107:Rnase10 UTSW 14 51009294 missense possibly damaging 0.89
R6994:Rnase10 UTSW 14 51009681 missense probably damaging 1.00
R7138:Rnase10 UTSW 14 51009710 missense probably damaging 1.00
R7186:Rnase10 UTSW 14 51009785 missense probably damaging 1.00
R7848:Rnase10 UTSW 14 51009513 missense possibly damaging 0.75
Predicted Primers PCR Primer
(F):5'- AAAGGAGCCTAATCAGAGCTGC -3'
(R):5'- AGAGATGGTCCATTCTCTCCTC -3'

Sequencing Primer
(F):5'- AGTACACGTTCATCCATGAGG -3'
(R):5'- CCCAGGATCTTCTCTATAGTTAGC -3'
Posted On2016-09-06