Incidental Mutation 'R5371:Speg'
ID428696
Institutional Source Beutler Lab
Gene Symbol Speg
Ensembl Gene ENSMUSG00000026207
Gene NameSPEG complex locus
SynonymsSPEGbeta, Apeg1, SPEGalpha, D1Bwg1450e, SPEG, BPEG
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5371 (G1)
Quality Score195
Status Validated
Chromosome1
Chromosomal Location75375297-75432320 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 75431393 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 3244 (R3244L)
Ref Sequence ENSEMBL: ENSMUSP00000084361 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037796] [ENSMUST00000087122] [ENSMUST00000113584] [ENSMUST00000131545] [ENSMUST00000133418] [ENSMUST00000140287] [ENSMUST00000141124] [ENSMUST00000143730] [ENSMUST00000144874] [ENSMUST00000145166]
Predicted Effect probably benign
Transcript: ENSMUST00000037796
SMART Domains Protein: ENSMUSP00000035564
Gene: ENSMUSG00000033021

DomainStartEndE-ValueType
Pfam:NTP_transferase 3 209 1.2e-30 PFAM
Pfam:NTP_transf_3 4 206 4.1e-10 PFAM
Pfam:Hexapep 280 321 2.6e-8 PFAM
low complexity region 357 365 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000087122
AA Change: R3244L

PolyPhen 2 Score 0.504 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000084361
Gene: ENSMUSG00000026207
AA Change: R3244L

DomainStartEndE-ValueType
IG 51 128 1.48e-6 SMART
low complexity region 292 318 N/A INTRINSIC
low complexity region 325 338 N/A INTRINSIC
low complexity region 359 368 N/A INTRINSIC
low complexity region 412 423 N/A INTRINSIC
low complexity region 573 584 N/A INTRINSIC
IGc2 739 806 2.19e-9 SMART
Pfam:SPEG_u2 817 873 2.4e-36 PFAM
IGc2 886 954 4.03e-8 SMART
IG 979 1064 1.05e-6 SMART
IGc2 1081 1148 2.19e-9 SMART
IG 1199 1283 6.87e-2 SMART
FN3 1287 1373 1.38e-4 SMART
IG 1401 1487 2.64e-3 SMART
IGc2 1502 1569 1.12e-6 SMART
STYKc 1606 1859 8.44e-63 SMART
Blast:STYKc 1861 1895 6e-12 BLAST
low complexity region 1918 1939 N/A INTRINSIC
low complexity region 2069 2081 N/A INTRINSIC
low complexity region 2208 2227 N/A INTRINSIC
low complexity region 2230 2249 N/A INTRINSIC
low complexity region 2255 2269 N/A INTRINSIC
low complexity region 2343 2366 N/A INTRINSIC
low complexity region 2410 2422 N/A INTRINSIC
low complexity region 2433 2451 N/A INTRINSIC
low complexity region 2457 2487 N/A INTRINSIC
low complexity region 2524 2544 N/A INTRINSIC
IGc2 2599 2667 2.05e-9 SMART
FN3 2681 2760 2.5e-2 SMART
low complexity region 2775 2789 N/A INTRINSIC
low complexity region 2802 2831 N/A INTRINSIC
low complexity region 2912 2927 N/A INTRINSIC
STYKc 2961 3213 4.42e-66 SMART
low complexity region 3241 3250 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113584
SMART Domains Protein: ENSMUSP00000109214
Gene: ENSMUSG00000033021

DomainStartEndE-ValueType
Pfam:NTP_transferase 3 209 1.6e-28 PFAM
Pfam:NTP_transf_3 4 206 1.6e-9 PFAM
Pfam:Hexapep 286 321 4.3e-8 PFAM
low complexity region 357 365 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000131545
SMART Domains Protein: ENSMUSP00000120841
Gene: ENSMUSG00000033021

DomainStartEndE-ValueType
Pfam:NTP_transferase 3 209 7.2e-31 PFAM
Pfam:NTP_transf_3 4 157 1.7e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000133418
SMART Domains Protein: ENSMUSP00000122443
Gene: ENSMUSG00000033021

DomainStartEndE-ValueType
Pfam:NTP_transferase 3 209 6.8e-31 PFAM
Pfam:NTP_transf_3 4 204 1e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000137868
AA Change: R2991L

PolyPhen 2 Score 0.055 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect probably benign
Transcript: ENSMUST00000140287
SMART Domains Protein: ENSMUSP00000121552
Gene: ENSMUSG00000033021

DomainStartEndE-ValueType
Pfam:NTP_transferase 3 161 1.7e-22 PFAM
Pfam:NTP_transf_3 4 155 6.1e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000141124
SMART Domains Protein: ENSMUSP00000116783
Gene: ENSMUSG00000033021

DomainStartEndE-ValueType
Pfam:NTP_transferase 3 72 1.1e-13 PFAM
Pfam:NTP_transf_3 4 71 1.9e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143679
Predicted Effect probably benign
Transcript: ENSMUST00000143730
SMART Domains Protein: ENSMUSP00000114375
Gene: ENSMUSG00000033021

DomainStartEndE-ValueType
Pfam:NTP_transferase 3 196 1.1e-30 PFAM
Pfam:NTP_transf_3 4 173 9.2e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144874
SMART Domains Protein: ENSMUSP00000121418
Gene: ENSMUSG00000033021

DomainStartEndE-ValueType
Pfam:NTP_transferase 1 174 6.6e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145166
SMART Domains Protein: ENSMUSP00000116754
Gene: ENSMUSG00000033021

DomainStartEndE-ValueType
Pfam:NTP_transferase 3 91 5.2e-15 PFAM
Pfam:NTP_transf_3 4 88 1.4e-9 PFAM
Meta Mutation Damage Score 0.2931 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 96% (71/74)
MGI Phenotype FUNCTION: This gene encodes a protein with similarity to members of the myosin light chain kinase family. This protein family is required for myocyte cytoskeletal development. Studies have determined that a lack of this protein affected myocardial development. Multiple alternatively spliced transcript variants that encode different protein isoforms have been defined. [provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for a knock-out allele die during the early postnatal period with enlarged, dilated hearts, and decreased cardiac function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432E11Rik G T 7: 29,562,493 noncoding transcript Het
Arpp21 G A 9: 112,065,932 P755S probably benign Het
Aspm C T 1: 139,470,541 Q982* probably null Het
Atp5e C T 2: 174,462,526 probably benign Het
BC024139 A G 15: 76,120,686 *598Q probably null Het
Bcl6 T A 16: 23,969,986 D544V possibly damaging Het
Ccdc9 A T 7: 16,280,730 D195E probably damaging Het
Cd38 A G 5: 43,868,883 N3S probably benign Het
Cfap46 A T 7: 139,632,181 probably null Het
Cmtr2 T C 8: 110,221,412 F118S probably damaging Het
Cyp7a1 A G 4: 6,268,378 F449S probably damaging Het
Dnah10 C T 5: 124,743,629 A509V probably benign Het
Dsp A T 13: 38,194,889 Q1271L probably damaging Het
E330021D16Rik T A 6: 136,401,373 Y153F probably benign Het
Edar A C 10: 58,607,452 V284G possibly damaging Het
Fdft1 A G 14: 63,151,301 V294A probably damaging Het
Gba T A 3: 89,205,471 V140E probably benign Het
Gm12185 A T 11: 48,915,739 S208R probably benign Het
Gm21028 C A 7: 42,578,522 E23* probably null Het
Gm6871 A G 7: 41,573,568 L32P probably benign Het
Hhip C T 8: 79,997,591 V341M probably damaging Het
Kcnq2 C A 2: 181,135,020 V25L probably damaging Het
Krit1 C A 5: 3,831,551 H548N probably damaging Het
Kynu C T 2: 43,589,394 A100V probably benign Het
Lpp T C 16: 24,889,804 C295R probably damaging Het
Mdp1 A G 14: 55,660,349 V9A probably damaging Het
Mllt3 T C 4: 87,840,856 I318M possibly damaging Het
Mpzl3 A G 9: 45,055,212 probably benign Het
Mroh2a A G 1: 88,258,664 S64G probably benign Het
Mup8 A G 4: 60,222,423 V16A probably benign Het
Myh13 T A 11: 67,344,790 probably null Het
Myh4 A T 11: 67,259,324 Q1869L probably damaging Het
Nt5c G A 11: 115,490,817 probably null Het
Olfr1173 C A 2: 88,274,632 C139F probably damaging Het
Olfr156 A T 4: 43,821,058 M101K probably damaging Het
Olfr573-ps1 T A 7: 102,942,512 M22L probably benign Het
Olfr908 CACAACAACA CACAACA 9: 38,516,138 probably benign Het
Parp11 T C 6: 127,470,792 F30L probably damaging Het
Pcdhgc3 A T 18: 37,808,454 D636V possibly damaging Het
Ppp1cb T C 5: 32,485,988 F234L probably damaging Het
Rras2 A T 7: 114,050,337 V164E probably damaging Het
Rsf1 GCGGCGGCG GCGGCGGCGACGGCGGCG 7: 97,579,913 probably benign Het
Scg3 T C 9: 75,661,301 T390A probably damaging Het
Shh C A 5: 28,466,690 C25F probably damaging Het
Slc24a1 T C 9: 64,949,268 K119R unknown Het
Spns1 A G 7: 126,373,764 probably benign Het
Sptbn4 A C 7: 27,359,741 probably null Het
Stap1 T A 5: 86,096,516 F214Y possibly damaging Het
Tcerg1 T A 18: 42,519,535 M76K unknown Het
Tjp1 A T 7: 65,313,311 Y959* probably null Het
Tmprss11e A T 5: 86,727,366 C14S probably benign Het
Tnfrsf14 T C 4: 154,922,477 probably null Het
Tsfm A C 10: 127,011,643 V193G probably benign Het
Ush2a A T 1: 188,443,070 I1122L probably benign Het
Vmn1r74 T A 7: 11,847,057 S95T probably damaging Het
Vmn2r98 G A 17: 19,069,753 C517Y probably damaging Het
Vstm2b G A 7: 40,901,278 S99N possibly damaging Het
Zbtb24 A G 10: 41,451,541 N141S probably benign Het
Zcchc4 T G 5: 52,785,170 C106G probably benign Het
Other mutations in Speg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00838:Speg APN 1 75410390 missense possibly damaging 0.95
IGL00979:Speg APN 1 75410734 missense probably damaging 0.98
IGL01122:Speg APN 1 75410035 missense probably damaging 1.00
IGL01293:Speg APN 1 75388102 missense probably damaging 1.00
IGL01304:Speg APN 1 75428197 missense probably benign 0.00
IGL01351:Speg APN 1 75411276 splice site probably benign
IGL01473:Speg APN 1 75428285 missense possibly damaging 0.53
IGL01477:Speg APN 1 75391897 missense probably damaging 1.00
IGL01485:Speg APN 1 75387827 missense probably damaging 1.00
IGL01584:Speg APN 1 75430937 missense probably damaging 1.00
IGL01959:Speg APN 1 75391090 missense probably damaging 1.00
IGL02231:Speg APN 1 75423387 missense probably damaging 1.00
IGL02355:Speg APN 1 75423915 missense possibly damaging 0.49
IGL02362:Speg APN 1 75423915 missense possibly damaging 0.49
IGL03013:Speg APN 1 75431279 missense probably damaging 0.97
IGL03168:Speg APN 1 75388187 missense probably damaging 1.00
H8562:Speg UTSW 1 75415597 missense probably benign 0.39
R0112:Speg UTSW 1 75385032 missense possibly damaging 0.92
R0311:Speg UTSW 1 75430937 missense probably damaging 1.00
R0315:Speg UTSW 1 75415136 missense possibly damaging 0.88
R0393:Speg UTSW 1 75423924 missense possibly damaging 0.46
R0403:Speg UTSW 1 75430784 splice site probably benign
R0483:Speg UTSW 1 75385032 missense possibly damaging 0.92
R0648:Speg UTSW 1 75427978 missense probably benign
R0683:Speg UTSW 1 75429118 missense probably damaging 1.00
R0800:Speg UTSW 1 75423489 missense probably damaging 1.00
R0815:Speg UTSW 1 75415392 missense probably damaging 1.00
R0835:Speg UTSW 1 75375674 missense probably benign 0.00
R0866:Speg UTSW 1 75417083 missense probably damaging 0.99
R0880:Speg UTSW 1 75405061 missense probably damaging 1.00
R1082:Speg UTSW 1 75415138 missense possibly damaging 0.94
R1140:Speg UTSW 1 75429095 missense probably damaging 1.00
R1252:Speg UTSW 1 75427095 missense probably damaging 1.00
R1301:Speg UTSW 1 75401501 missense probably damaging 1.00
R1348:Speg UTSW 1 75422872 missense probably damaging 0.99
R1388:Speg UTSW 1 75430460 missense probably damaging 0.99
R1465:Speg UTSW 1 75428484 splice site probably benign
R1505:Speg UTSW 1 75375542 missense probably benign 0.02
R1506:Speg UTSW 1 75417663 missense probably benign 0.03
R1531:Speg UTSW 1 75401222 missense possibly damaging 0.86
R1543:Speg UTSW 1 75421951 missense probably damaging 1.00
R1567:Speg UTSW 1 75428047 missense probably benign
R1630:Speg UTSW 1 75422977 missense probably damaging 1.00
R1667:Speg UTSW 1 75410549 splice site probably benign
R1673:Speg UTSW 1 75411163 missense possibly damaging 0.60
R1718:Speg UTSW 1 75417863 missense probably benign 0.00
R1718:Speg UTSW 1 75421744 missense possibly damaging 0.87
R1719:Speg UTSW 1 75417863 missense probably benign 0.00
R1759:Speg UTSW 1 75401162 missense possibly damaging 0.95
R1861:Speg UTSW 1 75389005 missense probably damaging 1.00
R1874:Speg UTSW 1 75423906 missense probably benign
R1936:Speg UTSW 1 75431408 missense possibly damaging 0.93
R2192:Speg UTSW 1 75417727 missense probably damaging 1.00
R2204:Speg UTSW 1 75430477 missense probably benign 0.30
R2287:Speg UTSW 1 75430465 missense possibly damaging 0.76
R2696:Speg UTSW 1 75406926 missense probably benign 0.27
R2983:Speg UTSW 1 75384930 missense possibly damaging 0.83
R3110:Speg UTSW 1 75422682 nonsense probably null
R3112:Speg UTSW 1 75422682 nonsense probably null
R3154:Speg UTSW 1 75401542 missense probably damaging 1.00
R3720:Speg UTSW 1 75426782 missense probably damaging 1.00
R3983:Speg UTSW 1 75422547 missense probably benign 0.27
R4133:Speg UTSW 1 75427904 missense probably benign
R4522:Speg UTSW 1 75428330 missense probably damaging 1.00
R4564:Speg UTSW 1 75391834 missense probably damaging 1.00
R4577:Speg UTSW 1 75415395 missense probably damaging 1.00
R4858:Speg UTSW 1 75421735 missense probably damaging 1.00
R4953:Speg UTSW 1 75423864 missense possibly damaging 0.72
R4965:Speg UTSW 1 75427703 missense probably damaging 1.00
R4967:Speg UTSW 1 75387869 missense probably damaging 1.00
R5152:Speg UTSW 1 75428098 missense possibly damaging 0.92
R5156:Speg UTSW 1 75428087 missense probably damaging 0.99
R5550:Speg UTSW 1 75429100 missense probably damaging 1.00
R5562:Speg UTSW 1 75427056 missense probably damaging 1.00
R5687:Speg UTSW 1 75419129 splice site probably null
R5985:Speg UTSW 1 75406684 missense possibly damaging 0.94
R6004:Speg UTSW 1 75415603 nonsense probably null
R6038:Speg UTSW 1 75418459 critical splice donor site probably null
R6038:Speg UTSW 1 75418459 critical splice donor site probably null
R6143:Speg UTSW 1 75414387 missense probably damaging 1.00
R6265:Speg UTSW 1 75406679 nonsense probably null
R6347:Speg UTSW 1 75426875 missense probably benign 0.00
R6453:Speg UTSW 1 75417972 missense probably benign 0.06
R6505:Speg UTSW 1 75406684 missense possibly damaging 0.94
R6505:Speg UTSW 1 75429523 missense possibly damaging 0.93
R6531:Speg UTSW 1 75422757 missense probably benign 0.03
R6566:Speg UTSW 1 75388463 missense probably damaging 1.00
R6747:Speg UTSW 1 75410395 critical splice donor site probably null
R6819:Speg UTSW 1 75391812 missense possibly damaging 0.56
R6821:Speg UTSW 1 75417903 missense possibly damaging 0.83
R6919:Speg UTSW 1 75387908 nonsense probably null
R6981:Speg UTSW 1 75430913 missense probably damaging 1.00
R7002:Speg UTSW 1 75423268 missense probably damaging 0.98
R7082:Speg UTSW 1 75411447 missense probably damaging 0.96
R7140:Speg UTSW 1 75406770 critical splice donor site probably null
R7175:Speg UTSW 1 75422490 missense probably benign 0.01
R7178:Speg UTSW 1 75422383 missense possibly damaging 0.46
R7345:Speg UTSW 1 75384835 missense probably damaging 0.97
R7420:Speg UTSW 1 75430905 missense probably damaging 1.00
R7537:Speg UTSW 1 75401464 missense probably damaging 1.00
R7562:Speg UTSW 1 75431279 missense probably damaging 0.97
R7615:Speg UTSW 1 75429242 missense probably damaging 1.00
R7679:Speg UTSW 1 75406315 missense probably damaging 1.00
R7692:Speg UTSW 1 75401190 missense probably benign 0.04
R7696:Speg UTSW 1 75429161 missense probably damaging 1.00
R7719:Speg UTSW 1 75375825 missense probably damaging 1.00
R7794:Speg UTSW 1 75388870 missense probably benign 0.00
R7824:Speg UTSW 1 75384017 splice site probably null
R7834:Speg UTSW 1 75384927 missense probably damaging 1.00
R7892:Speg UTSW 1 75427166 missense probably damaging 1.00
R8015:Speg UTSW 1 75415421 splice site probably benign
R8068:Speg UTSW 1 75422250 missense probably damaging 1.00
R8085:Speg UTSW 1 75415353 missense probably damaging 1.00
R8130:Speg UTSW 1 75415596 missense probably damaging 1.00
R8132:Speg UTSW 1 75422995 missense probably damaging 1.00
R8239:Speg UTSW 1 75419033 missense probably damaging 1.00
R8287:Speg UTSW 1 75422236 missense probably benign 0.26
R8299:Speg UTSW 1 75387836 missense possibly damaging 0.95
R8441:Speg UTSW 1 75411332 missense possibly damaging 0.60
R8468:Speg UTSW 1 75431309 missense probably damaging 1.00
R8555:Speg UTSW 1 75402264 splice site probably null
R8781:Speg UTSW 1 75407021 missense probably damaging 1.00
R8784:Speg UTSW 1 75405149 critical splice donor site probably benign
R8848:Speg UTSW 1 75427438 critical splice donor site probably null
R8881:Speg UTSW 1 75401151 missense possibly damaging 0.67
X0025:Speg UTSW 1 75422457 missense probably damaging 1.00
X0026:Speg UTSW 1 75423475 missense possibly damaging 0.88
Z1176:Speg UTSW 1 75406594 missense probably damaging 1.00
Z1177:Speg UTSW 1 75427683 missense probably damaging 1.00
Z1177:Speg UTSW 1 75428381 missense probably damaging 1.00
Z1177:Speg UTSW 1 75430455 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGAGCTTCTTTCCTGGTTCATG -3'
(R):5'- TCCATGAGGTAATAGCCCAGC -3'

Sequencing Primer
(F):5'- CATGATCTCTGGCTTGCCTGG -3'
(R):5'- GTAATAGCCCAGCCAGATGTTGC -3'
Posted On2016-09-06