Incidental Mutation 'R5371:Tcerg1'
ID428754
Institutional Source Beutler Lab
Gene Symbol Tcerg1
Ensembl Gene ENSMUSG00000024498
Gene Nametranscription elongation regulator 1 (CA150)
SynonymsTaf2s, 2410022J09Rik, 2900090C16Rik, Fbp28, p144, ca150
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5371 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location42511510-42575551 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 42519535 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 76 (M76K)
Ref Sequence ENSEMBL: ENSMUSP00000134458 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025375] [ENSMUST00000173642]
Predicted Effect unknown
Transcript: ENSMUST00000025375
AA Change: M76K
SMART Domains Protein: ENSMUSP00000025375
Gene: ENSMUSG00000024498
AA Change: M76K

DomainStartEndE-ValueType
low complexity region 3 13 N/A INTRINSIC
low complexity region 40 92 N/A INTRINSIC
WW 132 164 8.27e-10 SMART
low complexity region 178 257 N/A INTRINSIC
low complexity region 260 347 N/A INTRINSIC
low complexity region 350 373 N/A INTRINSIC
WW 432 464 2.65e-8 SMART
WW 531 563 1.2e-6 SMART
low complexity region 611 623 N/A INTRINSIC
coiled coil region 629 654 N/A INTRINSIC
FF 661 714 2.67e-13 SMART
FF 727 781 1.51e-12 SMART
FF 794 848 4.29e-17 SMART
FF 898 954 8.33e-15 SMART
FF 956 1012 1.47e-15 SMART
FF 1014 1079 1.3e-16 SMART
Predicted Effect unknown
Transcript: ENSMUST00000173642
AA Change: M76K
SMART Domains Protein: ENSMUSP00000134458
Gene: ENSMUSG00000024498
AA Change: M76K

DomainStartEndE-ValueType
low complexity region 3 13 N/A INTRINSIC
low complexity region 40 92 N/A INTRINSIC
WW 132 164 8.27e-10 SMART
low complexity region 178 257 N/A INTRINSIC
low complexity region 260 347 N/A INTRINSIC
low complexity region 350 373 N/A INTRINSIC
WW 432 464 2.65e-8 SMART
WW 531 563 1.2e-6 SMART
low complexity region 611 623 N/A INTRINSIC
coiled coil region 629 654 N/A INTRINSIC
FF 661 714 2.67e-13 SMART
FF 727 781 1.51e-12 SMART
FF 794 848 4.29e-17 SMART
FF 898 954 8.33e-15 SMART
FF 956 1012 1.47e-15 SMART
Meta Mutation Damage Score 0.1124 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 96% (71/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear protein that regulates transcriptional elongation and pre-mRNA splicing. The encoded protein interacts with the hyperphosphorylated C-terminal domain of RNA polymerase II via multiple FF domains, and with the pre-mRNA splicing factor SF1 via a WW domain. Alternative splicing results in multiple transcripts variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432E11Rik G T 7: 29,562,493 noncoding transcript Het
Arpp21 G A 9: 112,065,932 P755S probably benign Het
Aspm C T 1: 139,470,541 Q982* probably null Het
Atp5e C T 2: 174,462,526 probably benign Het
BC024139 A G 15: 76,120,686 *598Q probably null Het
Bcl6 T A 16: 23,969,986 D544V possibly damaging Het
Ccdc9 A T 7: 16,280,730 D195E probably damaging Het
Cd38 A G 5: 43,868,883 N3S probably benign Het
Cfap46 A T 7: 139,632,181 probably null Het
Cmtr2 T C 8: 110,221,412 F118S probably damaging Het
Cyp7a1 A G 4: 6,268,378 F449S probably damaging Het
Dnah10 C T 5: 124,743,629 A509V probably benign Het
Dsp A T 13: 38,194,889 Q1271L probably damaging Het
E330021D16Rik T A 6: 136,401,373 Y153F probably benign Het
Edar A C 10: 58,607,452 V284G possibly damaging Het
Fdft1 A G 14: 63,151,301 V294A probably damaging Het
Gba T A 3: 89,205,471 V140E probably benign Het
Gm12185 A T 11: 48,915,739 S208R probably benign Het
Gm21028 C A 7: 42,578,522 E23* probably null Het
Gm6871 A G 7: 41,573,568 L32P probably benign Het
Hhip C T 8: 79,997,591 V341M probably damaging Het
Kcnq2 C A 2: 181,135,020 V25L probably damaging Het
Krit1 C A 5: 3,831,551 H548N probably damaging Het
Kynu C T 2: 43,589,394 A100V probably benign Het
Lpp T C 16: 24,889,804 C295R probably damaging Het
Mdp1 A G 14: 55,660,349 V9A probably damaging Het
Mllt3 T C 4: 87,840,856 I318M possibly damaging Het
Mpzl3 A G 9: 45,055,212 probably benign Het
Mroh2a A G 1: 88,258,664 S64G probably benign Het
Mup8 A G 4: 60,222,423 V16A probably benign Het
Myh13 T A 11: 67,344,790 probably null Het
Myh4 A T 11: 67,259,324 Q1869L probably damaging Het
Nt5c G A 11: 115,490,817 probably null Het
Olfr1173 C A 2: 88,274,632 C139F probably damaging Het
Olfr156 A T 4: 43,821,058 M101K probably damaging Het
Olfr573-ps1 T A 7: 102,942,512 M22L probably benign Het
Olfr908 CACAACAACA CACAACA 9: 38,516,138 probably benign Het
Parp11 T C 6: 127,470,792 F30L probably damaging Het
Pcdhgc3 A T 18: 37,808,454 D636V possibly damaging Het
Ppp1cb T C 5: 32,485,988 F234L probably damaging Het
Rras2 A T 7: 114,050,337 V164E probably damaging Het
Rsf1 GCGGCGGCG GCGGCGGCGACGGCGGCG 7: 97,579,913 probably benign Het
Scg3 T C 9: 75,661,301 T390A probably damaging Het
Shh C A 5: 28,466,690 C25F probably damaging Het
Slc24a1 T C 9: 64,949,268 K119R unknown Het
Speg G T 1: 75,431,393 R3244L possibly damaging Het
Spns1 A G 7: 126,373,764 probably benign Het
Sptbn4 A C 7: 27,359,741 probably null Het
Stap1 T A 5: 86,096,516 F214Y possibly damaging Het
Tjp1 A T 7: 65,313,311 Y959* probably null Het
Tmprss11e A T 5: 86,727,366 C14S probably benign Het
Tnfrsf14 T C 4: 154,922,477 probably null Het
Tsfm A C 10: 127,011,643 V193G probably benign Het
Ush2a A T 1: 188,443,070 I1122L probably benign Het
Vmn1r74 T A 7: 11,847,057 S95T probably damaging Het
Vmn2r98 G A 17: 19,069,753 C517Y probably damaging Het
Vstm2b G A 7: 40,901,278 S99N possibly damaging Het
Zbtb24 A G 10: 41,451,541 N141S probably benign Het
Zcchc4 T G 5: 52,785,170 C106G probably benign Het
Other mutations in Tcerg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00701:Tcerg1 APN 18 42536342 missense probably benign 0.34
IGL00708:Tcerg1 APN 18 42571125 missense probably benign 0.38
IGL00741:Tcerg1 APN 18 42568453 missense possibly damaging 0.94
IGL01314:Tcerg1 APN 18 42573309 missense probably damaging 1.00
IGL01358:Tcerg1 APN 18 42524277 missense unknown
IGL01832:Tcerg1 APN 18 42574555 missense probably damaging 0.99
IGL01985:Tcerg1 APN 18 42530656 missense unknown
IGL02937:Tcerg1 APN 18 42524349 missense unknown
IGL02953:Tcerg1 APN 18 42548470 missense probably damaging 1.00
IGL03082:Tcerg1 APN 18 42573357 missense probably damaging 1.00
P0031:Tcerg1 UTSW 18 42573302 missense probably benign 0.07
R0060:Tcerg1 UTSW 18 42524008 missense unknown
R0138:Tcerg1 UTSW 18 42568614 splice site probably benign
R0482:Tcerg1 UTSW 18 42564240 splice site probably benign
R0502:Tcerg1 UTSW 18 42522956 missense unknown
R0731:Tcerg1 UTSW 18 42571840 missense probably damaging 0.99
R1117:Tcerg1 UTSW 18 42574652 missense probably damaging 0.99
R1542:Tcerg1 UTSW 18 42553430 missense probably damaging 0.99
R1571:Tcerg1 UTSW 18 42524292 missense unknown
R1673:Tcerg1 UTSW 18 42552581 missense possibly damaging 0.91
R1678:Tcerg1 UTSW 18 42524349 missense unknown
R1799:Tcerg1 UTSW 18 42560947 missense possibly damaging 0.92
R2094:Tcerg1 UTSW 18 42564145 missense possibly damaging 0.92
R2231:Tcerg1 UTSW 18 42524244 missense unknown
R2989:Tcerg1 UTSW 18 42519475 missense unknown
R3831:Tcerg1 UTSW 18 42568489 missense probably damaging 1.00
R4009:Tcerg1 UTSW 18 42564136 frame shift probably null
R4034:Tcerg1 UTSW 18 42519533 missense unknown
R4826:Tcerg1 UTSW 18 42535115 missense unknown
R4858:Tcerg1 UTSW 18 42523981 missense unknown
R5865:Tcerg1 UTSW 18 42536348 missense probably damaging 0.98
R6128:Tcerg1 UTSW 18 42511498 splice site probably null
R6258:Tcerg1 UTSW 18 42553465 missense probably damaging 1.00
R6260:Tcerg1 UTSW 18 42553465 missense probably damaging 1.00
R6516:Tcerg1 UTSW 18 42530892 critical splice donor site probably null
R6825:Tcerg1 UTSW 18 42548477 missense probably damaging 0.98
R7147:Tcerg1 UTSW 18 42550063 missense probably benign 0.22
R7714:Tcerg1 UTSW 18 42560935 missense possibly damaging 0.77
R7739:Tcerg1 UTSW 18 42523974 missense unknown
R7838:Tcerg1 UTSW 18 42536937 missense probably benign 0.01
R8204:Tcerg1 UTSW 18 42574553 missense probably damaging 1.00
R8293:Tcerg1 UTSW 18 42560955 missense probably benign 0.03
R8300:Tcerg1 UTSW 18 42550072 missense probably benign 0.22
R8426:Tcerg1 UTSW 18 42548401 missense possibly damaging 0.68
R8514:Tcerg1 UTSW 18 42564122 missense probably damaging 0.98
R8672:Tcerg1 UTSW 18 42553494 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACAGGATGGCTCAACAGC -3'
(R):5'- ACTGAAATAGATCTTTAGGAGCTAGAG -3'

Sequencing Primer
(F):5'- AACAGCAGGCCTTGAGGTTC -3'
(R):5'- ATGGATATCTGGCACACCTG -3'
Posted On2016-09-06