Mutagenetix > Incidental Mutation

Incidental Mutation 'R5372:Uggt1'

428756

Institutional Source

Beutler Lab

Gene Symbol

Uggt1

Ensembl Gene

ENSMUSG00000037470

Gene Name

UDP-glucose glycoprotein glucosyltransferase 1

Synonyms

Ugcgl1, C820010P03Rik, A930007H10Rik, 0910001L17Rik

MMRRC Submission

042948-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.388) question?

Stock #

R5372 (G1)

Quality Score

194

Status

Validated

Chromosome

Chromosomal Location

36140027-36244720 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

C to A at 36244060 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000134640 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000046875] [ENSMUST00000174266]

AlphaFold

Q6P5E4

Predicted Effect

probably benign
Transcript: ENSMUST00000046875

SMART Domains

Protein: ENSMUSP00000037930
Gene: ENSMUSG00000037470

Domain	Start	End	E-Value	Type
signal peptide	1	42	N/A	INTRINSIC
Pfam:UDP-g_GGTase	44	1222	N/A	PFAM
SCOP:d1ga8a_	1256	1521	3e-45	SMART
Blast:BROMO	1414	1453	3e-17	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000174266

SMART Domains

Protein: ENSMUSP00000134640
Gene: ENSMUSG00000037470

Domain	Start	End	E-Value	Type
signal peptide	1	42	N/A	INTRINSIC
low complexity region	88	97	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000174716

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000192159

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.2%
20x: 95.2%

Validation Efficiency

96% (89/93)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] UDP-glucose:glycoprotein glucosyltransferase (UGT) is a soluble protein of the endoplasmic reticulum (ER) that selectively reglucosylates unfolded glycoproteins, thus providing quality control for protein transport out of the ER.[supplied by OMIM, Oct 2009]
PHENOTYPE: Heterozygous KO reduces susceptibility to and morbidity of RNA virus infection. Homozygous KO is embryonic lethal. The peptide is a folding sensor for glycoproteins in the ER. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca4	T	A	3: 122,055,339	D108E	probably damaging	Het
Abhd12b	A	G	12: 70,181,026	D194G	probably damaging	Het
Adck5	A	G	15: 76,594,507		probably benign	Het
Adgrb3	C	T	1: 25,128,859	V792I	probably benign	Het
Anxa8	G	A	14: 34,093,911	V174M	probably damaging	Het
Apol9b	A	T	15: 77,735,720	R239W	probably benign	Het
Arhgap26	A	G	18: 38,642,456		noncoding transcript	Het
Atrnl1	A	G	19: 57,755,536	Y1190C	probably benign	Het
Brinp3	T	G	1: 146,831,726	L376R	probably damaging	Het
Btbd2	A	T	10: 80,648,641	M132K	probably damaging	Het
C130073F10Rik	A	T	4: 101,890,487	I115K	probably damaging	Het
C1ra	T	A	6: 124,521,625	Y426N	probably damaging	Het
Cacna1b	A	T	2: 24,733,959	V203E	probably damaging	Het
Catsperg1	T	A	7: 29,210,712	D68V	probably benign	Het
Ccdc158	A	C	5: 92,632,560	S885A	possibly damaging	Het
Cdc42bpa	T	C	1: 180,064,979	V236A	probably damaging	Het
Cdca7	A	T	2: 72,482,449	E176D	probably damaging	Het
Cdk17	A	G	10: 93,226,039	D211G	probably benign	Het
Clca3a2	A	C	3: 144,797,525	M888R	probably benign	Het
Clcn7	T	A	17: 25,157,179	M568K	possibly damaging	Het
Clip1	G	T	5: 123,630,240	N811K	probably benign	Het
Col12a1	T	A	9: 79,678,366	Y1243F	probably damaging	Het
Dctn1	T	A	6: 83,190,210	D315E	probably damaging	Het
Dgcr2	T	C	16: 17,872,644	T41A	probably benign	Het
Dync2h1	G	A	9: 7,176,962		probably benign	Het
Ep300	A	G	15: 81,636,830	I1264V	unknown	Het
Fam167b	A	T	4: 129,578,299	L26Q	possibly damaging	Het
Fam178b	T	A	1: 36,564,848	I457F	possibly damaging	Het
Fgd4	A	T	16: 16,484,291	N133K	probably benign	Het
Fndc1	C	G	17: 7,765,210	V1295L	unknown	Het
Gad2	A	T	2: 22,690,243	D552V	possibly damaging	Het
Hars2	T	C	18: 36,790,481	Y361H	possibly damaging	Het
Heca	T	A	10: 17,915,139	S390C	probably damaging	Het
Hephl1	G	T	9: 15,097,899	Y132*	probably null	Het
Hormad1	T	A	3: 95,576,424	D182E	probably damaging	Het
Ifna15	G	A	4: 88,558,101	P49S	probably damaging	Het
Khsrp	T	C	17: 57,024,292	T429A	possibly damaging	Het
Magi2	A	G	5: 20,702,110	Q1094R	possibly damaging	Het
Map3k11	T	A	19: 5,690,962	I239K	probably damaging	Het
Mtus2	A	G	5: 148,313,412	T1319A	probably damaging	Het
Nup54	A	G	5: 92,417,857	I406T	probably damaging	Het
Nxpe2	T	C	9: 48,339,519	T43A	possibly damaging	Het
Nynrin	A	G	14: 55,868,491	E889G	probably benign	Het
Olfr1313	A	G	2: 112,072,109	I158T	probably benign	Het
Olfr160	T	C	9: 37,711,938	M114V	possibly damaging	Het
Olfr301	T	A	7: 86,412,968	I202N	possibly damaging	Het
Olfr663	A	G	7: 104,703,795	D76G	probably benign	Het
Opa1	A	C	16: 29,586,119	H45P	probably benign	Het
Otx1	C	A	11: 21,997,037	A91S	probably damaging	Het
Papola	A	G	12: 105,827,050	K543R	probably benign	Het
Plcxd3	G	A	15: 4,574,788	V293I	probably benign	Het
Polr2g	T	C	19: 8,797,303	Y72C	probably damaging	Het
Ppp1r21	A	G	17: 88,550,675	K205E	probably benign	Het
Ptpre	A	G	7: 135,653,940	K53E	possibly damaging	Het
Rasal3	T	C	17: 32,391,344	K990E	probably benign	Het
Rgs3	A	T	4: 62,652,697		probably benign	Het
Rhd	A	G	4: 134,884,632	T254A	possibly damaging	Het
Rufy4	T	C	1: 74,147,663	C537R	probably damaging	Het
Scube3	G	T	17: 28,152,482	C57F	probably damaging	Het
Sh2d5	A	G	4: 138,254,699	D57G	possibly damaging	Het
Slc12a6	T	A	2: 112,347,360	L608*	probably null	Het
Slk	A	T	19: 47,625,393	N896I	probably damaging	Het
Smc6	A	G	12: 11,282,430	D211G	probably damaging	Het
Sox6	A	T	7: 115,550,151	Y371*	probably null	Het
Srcap	G	A	7: 127,557,613		probably null	Het
Stard5	T	A	7: 83,633,220	D80E	probably damaging	Het
Supv3l1	C	T	10: 62,432,357	V570M	probably damaging	Het
Syt7	G	T	19: 10,426,621	V180L	probably damaging	Het
Tacc2	T	A	7: 130,623,260	H558Q	probably benign	Het
Tas2r120	T	A	6: 132,657,483	M176K	possibly damaging	Het
Tmem135	A	T	7: 89,165,174		probably null	Het
Trim35	T	C	14: 66,297,266	V66A	possibly damaging	Het
Tspan12	A	G	6: 21,772,699	S284P	probably benign	Het
Ttll3	A	T	6: 113,401,421	K257*	probably null	Het
Vmn2r7	T	A	3: 64,716,324	I283F	probably damaging	Het
Wdfy2	T	G	14: 62,954,885	H363Q	probably damaging	Het
Wdr4	T	A	17: 31,510,580	K95N	probably damaging	Het
Zfp141	T	C	7: 42,477,196	N91S	possibly damaging	Het
Zfp383	C	T	7: 29,915,270	R317*	probably null	Het

Other mutations in Uggt1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00091:Uggt1	APN	1	36179552	splice site	probably benign
IGL00817:Uggt1	APN	1	36185932	missense	probably benign	0.03
IGL01395:Uggt1	APN	1	36155077	missense	probably damaging	1.00
IGL01609:Uggt1	APN	1	36182474	missense	probably damaging	1.00
IGL01619:Uggt1	APN	1	36161694	missense	probably damaging	0.99
IGL02077:Uggt1	APN	1	36176794	missense	probably damaging	0.99
IGL02313:Uggt1	APN	1	36184484	missense	probably damaging	0.99
IGL02341:Uggt1	APN	1	36164519	makesense	probably null
IGL02346:Uggt1	APN	1	36179670	missense	probably benign	0.00
IGL02447:Uggt1	APN	1	36150142	missense	probably damaging	1.00
IGL02883:Uggt1	APN	1	36177615	missense	probably benign	0.03
IGL02930:Uggt1	APN	1	36157456	missense	probably benign	0.01
IGL03153:Uggt1	APN	1	36202818	missense	possibly damaging	0.94
IGL03162:Uggt1	APN	1	36207956	missense	probably damaging	1.00
IGL03170:Uggt1	APN	1	36163261	missense	probably damaging	1.00
IGL03266:Uggt1	APN	1	36150048	missense	probably damaging	1.00
K3955:Uggt1	UTSW	1	36162353	missense	probably benign	0.37
R0037:Uggt1	UTSW	1	36185932	missense	probably benign	0.03
R0037:Uggt1	UTSW	1	36185932	missense	probably benign	0.03
R0167:Uggt1	UTSW	1	36170197	critical splice donor site	probably null
R0373:Uggt1	UTSW	1	36179670	missense	probably benign	0.00
R0502:Uggt1	UTSW	1	36159946	missense	probably damaging	1.00
R0546:Uggt1	UTSW	1	36195971	missense	probably benign	0.00
R0610:Uggt1	UTSW	1	36165506	splice site	probably benign
R0671:Uggt1	UTSW	1	36155128	missense	probably damaging	1.00
R0760:Uggt1	UTSW	1	36161724	missense	possibly damaging	0.68
R0825:Uggt1	UTSW	1	36158143	missense	probably benign	0.01
R0827:Uggt1	UTSW	1	36156313	critical splice acceptor site	probably null
R0884:Uggt1	UTSW	1	36175078	missense	probably benign	0.00
R1112:Uggt1	UTSW	1	36173546	missense	possibly damaging	0.54
R1470:Uggt1	UTSW	1	36176796	missense	probably benign	0.13
R1470:Uggt1	UTSW	1	36176796	missense	probably benign	0.13
R1592:Uggt1	UTSW	1	36202858	missense	probably benign	0.04
R1730:Uggt1	UTSW	1	36221261	missense	probably benign	0.05
R1923:Uggt1	UTSW	1	36179613	missense	probably damaging	0.99
R1970:Uggt1	UTSW	1	36151781	missense	probably damaging	1.00
R2086:Uggt1	UTSW	1	36192414	missense	probably null	1.00
R2829:Uggt1	UTSW	1	36162294	missense	probably benign	0.38
R3431:Uggt1	UTSW	1	36210059	nonsense	probably null
R3432:Uggt1	UTSW	1	36210059	nonsense	probably null
R3725:Uggt1	UTSW	1	36182507	nonsense	probably null
R3880:Uggt1	UTSW	1	36176804	intron	probably benign
R4052:Uggt1	UTSW	1	36164489	missense	probably damaging	0.98
R4133:Uggt1	UTSW	1	36158159	missense	probably damaging	1.00
R4489:Uggt1	UTSW	1	36146668	nonsense	probably null
R4570:Uggt1	UTSW	1	36150073	missense	probably damaging	1.00
R4866:Uggt1	UTSW	1	36202855	nonsense	probably null
R4895:Uggt1	UTSW	1	36156264	missense	probably damaging	1.00
R4900:Uggt1	UTSW	1	36202855	nonsense	probably null
R5385:Uggt1	UTSW	1	36184412	missense	probably damaging	1.00
R5652:Uggt1	UTSW	1	36216153	nonsense	probably null
R5694:Uggt1	UTSW	1	36179656	missense	probably damaging	1.00
R5732:Uggt1	UTSW	1	36161771	splice site	probably null
R5893:Uggt1	UTSW	1	36227628	splice site	probably null
R6191:Uggt1	UTSW	1	36162208	missense	probably damaging	0.98
R6247:Uggt1	UTSW	1	36163228	missense	probably damaging	1.00
R6259:Uggt1	UTSW	1	36234916	missense	probably benign	0.00
R6399:Uggt1	UTSW	1	36163366	missense	possibly damaging	0.90
R6439:Uggt1	UTSW	1	36174951	missense	possibly damaging	0.95
R6468:Uggt1	UTSW	1	36173450	missense	probably benign	0.00
R6788:Uggt1	UTSW	1	36230688	missense	probably benign	0.00
R7165:Uggt1	UTSW	1	36155107	missense	probably benign	0.41
R7255:Uggt1	UTSW	1	36146106	missense	probably damaging	1.00
R7273:Uggt1	UTSW	1	36162221	missense	probably damaging	0.99
R7469:Uggt1	UTSW	1	36151733	missense	probably damaging	1.00
R7490:Uggt1	UTSW	1	36164508	missense	probably benign	0.01
R7570:Uggt1	UTSW	1	36185838	missense	probably benign	0.09
R7612:Uggt1	UTSW	1	36163235	missense	probably damaging	0.99
R7759:Uggt1	UTSW	1	36146725	missense	possibly damaging	0.81
R7792:Uggt1	UTSW	1	36207984	missense	probably damaging	1.00
R7816:Uggt1	UTSW	1	36163315	missense	possibly damaging	0.95
R7858:Uggt1	UTSW	1	36156258	missense	probably damaging	1.00
R7887:Uggt1	UTSW	1	36208034	missense	probably damaging	0.99
R8040:Uggt1	UTSW	1	36211473	missense	possibly damaging	0.70
R8093:Uggt1	UTSW	1	36227485	missense	probably damaging	1.00
R8245:Uggt1	UTSW	1	36165564	missense	probably damaging	1.00
R8338:Uggt1	UTSW	1	36227521	missense	probably damaging	1.00
R8353:Uggt1	UTSW	1	36170296	critical splice acceptor site	probably null
R8442:Uggt1	UTSW	1	36173487	missense	probably damaging	0.99
R8519:Uggt1	UTSW	1	36176643	splice site	probably null
R8529:Uggt1	UTSW	1	36184432	missense	possibly damaging	0.85
R8730:Uggt1	UTSW	1	36197543	critical splice donor site	probably null
R8917:Uggt1	UTSW	1	36146654	missense
R8947:Uggt1	UTSW	1	36158148	missense	probably benign	0.12
R9240:Uggt1	UTSW	1	36182615	missense	possibly damaging	0.50
R9248:Uggt1	UTSW	1	36210022	missense	possibly damaging	0.80
R9401:Uggt1	UTSW	1	36216131	critical splice donor site	probably null
R9414:Uggt1	UTSW	1	36184426	missense	probably benign	0.01
R9416:Uggt1	UTSW	1	36164522	missense
R9441:Uggt1	UTSW	1	36221225	missense	probably benign	0.02
R9489:Uggt1	UTSW	1	36234805	critical splice donor site	probably null
R9563:Uggt1	UTSW	1	36165546	missense	possibly damaging	0.60
X0022:Uggt1	UTSW	1	36165555	missense	possibly damaging	0.67
Z1088:Uggt1	UTSW	1	36174191	missense	probably damaging	1.00
Z1176:Uggt1	UTSW	1	36161695	missense	probably damaging	1.00
Z1177:Uggt1	UTSW	1	36155073	missense	probably null	1.00

Predicted Primers

PCR Primer
(F):5'- TTCAAACAGGGTCAGGACTGC -3'
(R):5'- TTGAGAAACCGGCTTGTGAG -3'

Sequencing Primer
(F):5'- TCAGGACTGCTGGAGTGAGC -3'
(R):5'- AACCGGCTTGTGAGGAGCG -3'

Posted On

2016-09-06