Incidental Mutation 'R5372:Nup54'
ID428778
Institutional Source Beutler Lab
Gene Symbol Nup54
Ensembl Gene ENSMUSG00000034826
Gene Namenucleoporin 54
Synonyms54kDa, 3110079L04Rik
MMRRC Submission 042948-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.964) question?
Stock #R5372 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location92415540-92435219 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 92417857 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 406 (I406T)
Ref Sequence ENSEMBL: ENSMUSP00000046540 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038514] [ENSMUST00000113083] [ENSMUST00000117108] [ENSMUST00000118106] [ENSMUST00000119587] [ENSMUST00000120193] [ENSMUST00000120416] [ENSMUST00000121096] [ENSMUST00000152041]
Predicted Effect probably damaging
Transcript: ENSMUST00000038514
AA Change: I406T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000046540
Gene: ENSMUSG00000034826
AA Change: I406T

DomainStartEndE-ValueType
low complexity region 5 109 N/A INTRINSIC
Pfam:Nup54 303 441 4.8e-49 PFAM
PDB:3T98|C 445 494 2e-26 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000113083
SMART Domains Protein: ENSMUSP00000108706
Gene: ENSMUSG00000034842

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:ART 29 251 4.4e-65 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000117108
SMART Domains Protein: ENSMUSP00000113041
Gene: ENSMUSG00000034842

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:ART 29 251 1.9e-65 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118106
SMART Domains Protein: ENSMUSP00000114083
Gene: ENSMUSG00000034842

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:ART 29 251 9e-66 PFAM
low complexity region 298 309 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119587
SMART Domains Protein: ENSMUSP00000112648
Gene: ENSMUSG00000034842

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:ART 29 251 4e-65 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120193
SMART Domains Protein: ENSMUSP00000113074
Gene: ENSMUSG00000034842

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:ART 29 251 8.4e-66 PFAM
low complexity region 298 309 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120416
SMART Domains Protein: ENSMUSP00000113493
Gene: ENSMUSG00000034842

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:ART 29 251 3.1e-65 PFAM
low complexity region 298 309 N/A INTRINSIC
low complexity region 366 373 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121096
SMART Domains Protein: ENSMUSP00000113510
Gene: ENSMUSG00000034842

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:ART 29 251 1.8e-65 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123694
Predicted Effect probably benign
Transcript: ENSMUST00000126281
SMART Domains Protein: ENSMUSP00000116110
Gene: ENSMUSG00000034842

DomainStartEndE-ValueType
Pfam:ART 1 190 3e-53 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129222
Predicted Effect probably benign
Transcript: ENSMUST00000138003
Predicted Effect probably benign
Transcript: ENSMUST00000152041
Meta Mutation Damage Score 0.6848 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 96% (89/93)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The nuclear envelope creates distinct nuclear and cytoplasmic compartments in eukaryotic cells. It consists of two concentric membranes perforated by nuclear pores, large protein complexes that form aqueous channels to regulate the flow of macromolecules between the nucleus and the cytoplasm. These complexes are composed of at least 100 different polypeptide subunits, many of which belong to the nucleoporin family. This gene encodes a member of the phe-gly (FG) repeat-containing nucleoporin subset. Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jun 2013]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 T A 3: 122,055,339 D108E probably damaging Het
Abhd12b A G 12: 70,181,026 D194G probably damaging Het
Adck5 A G 15: 76,594,507 probably benign Het
Adgrb3 C T 1: 25,128,859 V792I probably benign Het
Anxa8 G A 14: 34,093,911 V174M probably damaging Het
Apol9b A T 15: 77,735,720 R239W probably benign Het
Arhgap26 A G 18: 38,642,456 noncoding transcript Het
Atrnl1 A G 19: 57,755,536 Y1190C probably benign Het
Brinp3 T G 1: 146,831,726 L376R probably damaging Het
Btbd2 A T 10: 80,648,641 M132K probably damaging Het
C130073F10Rik A T 4: 101,890,487 I115K probably damaging Het
C1ra T A 6: 124,521,625 Y426N probably damaging Het
Cacna1b A T 2: 24,733,959 V203E probably damaging Het
Catsperg1 T A 7: 29,210,712 D68V probably benign Het
Ccdc158 A C 5: 92,632,560 S885A possibly damaging Het
Cdc42bpa T C 1: 180,064,979 V236A probably damaging Het
Cdca7 A T 2: 72,482,449 E176D probably damaging Het
Cdk17 A G 10: 93,226,039 D211G probably benign Het
Clca3a2 A C 3: 144,797,525 M888R probably benign Het
Clcn7 T A 17: 25,157,179 M568K possibly damaging Het
Clip1 G T 5: 123,630,240 N811K probably benign Het
Col12a1 T A 9: 79,678,366 Y1243F probably damaging Het
Dctn1 T A 6: 83,190,210 D315E probably damaging Het
Dgcr2 T C 16: 17,872,644 T41A probably benign Het
Dync2h1 G A 9: 7,176,962 probably benign Het
Ep300 A G 15: 81,636,830 I1264V unknown Het
Fam167b A T 4: 129,578,299 L26Q possibly damaging Het
Fam178b T A 1: 36,564,848 I457F possibly damaging Het
Fgd4 A T 16: 16,484,291 N133K probably benign Het
Fndc1 C G 17: 7,765,210 V1295L unknown Het
Gad2 A T 2: 22,690,243 D552V possibly damaging Het
Hars2 T C 18: 36,790,481 Y361H possibly damaging Het
Heca T A 10: 17,915,139 S390C probably damaging Het
Hephl1 G T 9: 15,097,899 Y132* probably null Het
Hormad1 T A 3: 95,576,424 D182E probably damaging Het
Ifna15 G A 4: 88,558,101 P49S probably damaging Het
Khsrp T C 17: 57,024,292 T429A possibly damaging Het
Magi2 A G 5: 20,702,110 Q1094R possibly damaging Het
Map3k11 T A 19: 5,690,962 I239K probably damaging Het
Mtus2 A G 5: 148,313,412 T1319A probably damaging Het
Nxpe2 T C 9: 48,339,519 T43A possibly damaging Het
Nynrin A G 14: 55,868,491 E889G probably benign Het
Olfr1313 A G 2: 112,072,109 I158T probably benign Het
Olfr160 T C 9: 37,711,938 M114V possibly damaging Het
Olfr301 T A 7: 86,412,968 I202N possibly damaging Het
Olfr663 A G 7: 104,703,795 D76G probably benign Het
Opa1 A C 16: 29,586,119 H45P probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Papola A G 12: 105,827,050 K543R probably benign Het
Plcxd3 G A 15: 4,574,788 V293I probably benign Het
Polr2g T C 19: 8,797,303 Y72C probably damaging Het
Ppp1r21 A G 17: 88,550,675 K205E probably benign Het
Ptpre A G 7: 135,653,940 K53E possibly damaging Het
Rasal3 T C 17: 32,391,344 K990E probably benign Het
Rgs3 A T 4: 62,652,697 probably benign Het
Rhd A G 4: 134,884,632 T254A possibly damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Scube3 G T 17: 28,152,482 C57F probably damaging Het
Sh2d5 A G 4: 138,254,699 D57G possibly damaging Het
Slc12a6 T A 2: 112,347,360 L608* probably null Het
Slk A T 19: 47,625,393 N896I probably damaging Het
Smc6 A G 12: 11,282,430 D211G probably damaging Het
Sox6 A T 7: 115,550,151 Y371* probably null Het
Srcap G A 7: 127,557,613 probably null Het
Stard5 T A 7: 83,633,220 D80E probably damaging Het
Supv3l1 C T 10: 62,432,357 V570M probably damaging Het
Syt7 G T 19: 10,426,621 V180L probably damaging Het
Tacc2 T A 7: 130,623,260 H558Q probably benign Het
Tas2r120 T A 6: 132,657,483 M176K possibly damaging Het
Tmem135 A T 7: 89,165,174 probably null Het
Trim35 T C 14: 66,297,266 V66A possibly damaging Het
Tspan12 A G 6: 21,772,699 S284P probably benign Het
Ttll3 A T 6: 113,401,421 K257* probably null Het
Uggt1 C A 1: 36,244,060 probably benign Het
Vmn2r7 T A 3: 64,716,324 I283F probably damaging Het
Wdfy2 T G 14: 62,954,885 H363Q probably damaging Het
Wdr4 T A 17: 31,510,580 K95N probably damaging Het
Zfp141 T C 7: 42,477,196 N91S possibly damaging Het
Zfp383 C T 7: 29,915,270 R317* probably null Het
Other mutations in Nup54
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00491:Nup54 APN 5 92417485 missense probably benign 0.00
IGL01526:Nup54 APN 5 92417475 missense probably benign 0.12
IGL01924:Nup54 APN 5 92424435 missense probably benign 0.02
IGL02248:Nup54 APN 5 92428329 splice site probably null
IGL02253:Nup54 APN 5 92417451 critical splice donor site probably null
IGL02508:Nup54 APN 5 92417539 nonsense probably null
IGL02721:Nup54 APN 5 92417857 missense possibly damaging 0.96
IGL03150:Nup54 APN 5 92428164 missense probably damaging 1.00
R0189:Nup54 UTSW 5 92422564 missense probably damaging 1.00
R1401:Nup54 UTSW 5 92428221 missense probably damaging 1.00
R1862:Nup54 UTSW 5 92419567 missense possibly damaging 0.75
R3938:Nup54 UTSW 5 92417529 missense probably damaging 1.00
R4171:Nup54 UTSW 5 92417484 missense possibly damaging 0.64
R4574:Nup54 UTSW 5 92425782 missense probably benign 0.17
R6003:Nup54 UTSW 5 92422994 missense probably damaging 1.00
R6191:Nup54 UTSW 5 92424294 missense probably damaging 0.99
R6197:Nup54 UTSW 5 92430804 utr 3 prime probably benign
R7861:Nup54 UTSW 5 92431093 missense unknown
R8005:Nup54 UTSW 5 92428147 missense probably benign 0.00
R8016:Nup54 UTSW 5 92434317 missense unknown
R8439:Nup54 UTSW 5 92425746 missense probably benign 0.22
R8709:Nup54 UTSW 5 92422408 intron probably benign
Z1177:Nup54 UTSW 5 92434279 missense unknown
Predicted Primers PCR Primer
(F):5'- GCTTTAGTACAAGCTAAGCAAACC -3'
(R):5'- AGGCATACATGTAAAGGCGC -3'

Sequencing Primer
(F):5'- CCATGACAGAATTTATTCCTGTGTG -3'
(R):5'- AGTTCTGCAGCATAGACTAGCCTG -3'
Posted On2016-09-06