Incidental Mutation 'R5372:Ttll3'
ID428784
Institutional Source Beutler Lab
Gene Symbol Ttll3
Ensembl Gene ENSMUSG00000030276
Gene Nametubulin tyrosine ligase-like family, member 3
Synonyms
MMRRC Submission 042948-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5372 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location113389260-113414587 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 113401421 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 257 (K257*)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032414] [ENSMUST00000038889] [ENSMUST00000204026] [ENSMUST00000205017]
Predicted Effect probably null
Transcript: ENSMUST00000032414
AA Change: K410*
SMART Domains Protein: ENSMUSP00000032414
Gene: ENSMUSG00000030276
AA Change: K410*

DomainStartEndE-ValueType
low complexity region 3 20 N/A INTRINSIC
low complexity region 214 231 N/A INTRINSIC
low complexity region 234 248 N/A INTRINSIC
Pfam:TTL 404 698 7.7e-84 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000038889
AA Change: K411*
SMART Domains Protein: ENSMUSP00000037870
Gene: ENSMUSG00000030276
AA Change: K411*

DomainStartEndE-ValueType
low complexity region 3 20 N/A INTRINSIC
low complexity region 214 231 N/A INTRINSIC
low complexity region 234 248 N/A INTRINSIC
Pfam:TTL 404 699 9e-85 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000138131
AA Change: K257*
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161831
AA Change: Q214L
Predicted Effect probably null
Transcript: ENSMUST00000203524
AA Change: K257*
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203925
Predicted Effect probably benign
Transcript: ENSMUST00000204026
SMART Domains Protein: ENSMUSP00000145049
Gene: ENSMUSG00000030276

DomainStartEndE-ValueType
low complexity region 66 83 N/A INTRINSIC
low complexity region 86 100 N/A INTRINSIC
low complexity region 248 259 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204683
Predicted Effect probably benign
Transcript: ENSMUST00000205017
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 96% (89/93)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit a reduced number of primary cilia in colon epithelia accompanied by an increased rate of cell division which is compensated by faster tissue turnover in the colon. Mice exhibit increased incidence of colon tumors by chemical induction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 T A 3: 122,055,339 D108E probably damaging Het
Abhd12b A G 12: 70,181,026 D194G probably damaging Het
Adck5 A G 15: 76,594,507 probably benign Het
Adgrb3 C T 1: 25,128,859 V792I probably benign Het
Anxa8 G A 14: 34,093,911 V174M probably damaging Het
Apol9b A T 15: 77,735,720 R239W probably benign Het
Arhgap26 A G 18: 38,642,456 noncoding transcript Het
Atrnl1 A G 19: 57,755,536 Y1190C probably benign Het
Brinp3 T G 1: 146,831,726 L376R probably damaging Het
Btbd2 A T 10: 80,648,641 M132K probably damaging Het
C130073F10Rik A T 4: 101,890,487 I115K probably damaging Het
C1ra T A 6: 124,521,625 Y426N probably damaging Het
Cacna1b A T 2: 24,733,959 V203E probably damaging Het
Catsperg1 T A 7: 29,210,712 D68V probably benign Het
Ccdc158 A C 5: 92,632,560 S885A possibly damaging Het
Cdc42bpa T C 1: 180,064,979 V236A probably damaging Het
Cdca7 A T 2: 72,482,449 E176D probably damaging Het
Cdk17 A G 10: 93,226,039 D211G probably benign Het
Clca3a2 A C 3: 144,797,525 M888R probably benign Het
Clcn7 T A 17: 25,157,179 M568K possibly damaging Het
Clip1 G T 5: 123,630,240 N811K probably benign Het
Col12a1 T A 9: 79,678,366 Y1243F probably damaging Het
Dctn1 T A 6: 83,190,210 D315E probably damaging Het
Dgcr2 T C 16: 17,872,644 T41A probably benign Het
Dync2h1 G A 9: 7,176,962 probably benign Het
Ep300 A G 15: 81,636,830 I1264V unknown Het
Fam167b A T 4: 129,578,299 L26Q possibly damaging Het
Fam178b T A 1: 36,564,848 I457F possibly damaging Het
Fgd4 A T 16: 16,484,291 N133K probably benign Het
Fndc1 C G 17: 7,765,210 V1295L unknown Het
Gad2 A T 2: 22,690,243 D552V possibly damaging Het
Hars2 T C 18: 36,790,481 Y361H possibly damaging Het
Heca T A 10: 17,915,139 S390C probably damaging Het
Hephl1 G T 9: 15,097,899 Y132* probably null Het
Hormad1 T A 3: 95,576,424 D182E probably damaging Het
Ifna15 G A 4: 88,558,101 P49S probably damaging Het
Khsrp T C 17: 57,024,292 T429A possibly damaging Het
Magi2 A G 5: 20,702,110 Q1094R possibly damaging Het
Map3k11 T A 19: 5,690,962 I239K probably damaging Het
Mtus2 A G 5: 148,313,412 T1319A probably damaging Het
Nup54 A G 5: 92,417,857 I406T probably damaging Het
Nxpe2 T C 9: 48,339,519 T43A possibly damaging Het
Nynrin A G 14: 55,868,491 E889G probably benign Het
Olfr1313 A G 2: 112,072,109 I158T probably benign Het
Olfr160 T C 9: 37,711,938 M114V possibly damaging Het
Olfr301 T A 7: 86,412,968 I202N possibly damaging Het
Olfr663 A G 7: 104,703,795 D76G probably benign Het
Opa1 A C 16: 29,586,119 H45P probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Papola A G 12: 105,827,050 K543R probably benign Het
Plcxd3 G A 15: 4,574,788 V293I probably benign Het
Polr2g T C 19: 8,797,303 Y72C probably damaging Het
Ppp1r21 A G 17: 88,550,675 K205E probably benign Het
Ptpre A G 7: 135,653,940 K53E possibly damaging Het
Rasal3 T C 17: 32,391,344 K990E probably benign Het
Rgs3 A T 4: 62,652,697 probably benign Het
Rhd A G 4: 134,884,632 T254A possibly damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Scube3 G T 17: 28,152,482 C57F probably damaging Het
Sh2d5 A G 4: 138,254,699 D57G possibly damaging Het
Slc12a6 T A 2: 112,347,360 L608* probably null Het
Slk A T 19: 47,625,393 N896I probably damaging Het
Smc6 A G 12: 11,282,430 D211G probably damaging Het
Sox6 A T 7: 115,550,151 Y371* probably null Het
Srcap G A 7: 127,557,613 probably null Het
Stard5 T A 7: 83,633,220 D80E probably damaging Het
Supv3l1 C T 10: 62,432,357 V570M probably damaging Het
Syt7 G T 19: 10,426,621 V180L probably damaging Het
Tacc2 T A 7: 130,623,260 H558Q probably benign Het
Tas2r120 T A 6: 132,657,483 M176K possibly damaging Het
Tmem135 A T 7: 89,165,174 probably null Het
Trim35 T C 14: 66,297,266 V66A possibly damaging Het
Tspan12 A G 6: 21,772,699 S284P probably benign Het
Uggt1 C A 1: 36,244,060 probably benign Het
Vmn2r7 T A 3: 64,716,324 I283F probably damaging Het
Wdfy2 T G 14: 62,954,885 H363Q probably damaging Het
Wdr4 T A 17: 31,510,580 K95N probably damaging Het
Zfp141 T C 7: 42,477,196 N91S possibly damaging Het
Zfp383 C T 7: 29,915,270 R317* probably null Het
Other mutations in Ttll3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01338:Ttll3 APN 6 113394729 missense probably damaging 1.00
IGL01677:Ttll3 APN 6 113412984 missense probably benign
IGL01697:Ttll3 APN 6 113399729 missense probably benign 0.00
IGL01944:Ttll3 APN 6 113414115 missense probably benign
IGL02688:Ttll3 APN 6 113399739 missense probably benign 0.00
IGL03068:Ttll3 APN 6 113409197 missense probably damaging 1.00
R0373:Ttll3 UTSW 6 113398777 missense probably damaging 1.00
R0472:Ttll3 UTSW 6 113409339 missense probably damaging 1.00
R0625:Ttll3 UTSW 6 113408903 critical splice acceptor site probably null
R1868:Ttll3 UTSW 6 113392764 missense possibly damaging 0.95
R2026:Ttll3 UTSW 6 113398770 missense probably damaging 1.00
R2061:Ttll3 UTSW 6 113409042 missense possibly damaging 0.76
R2128:Ttll3 UTSW 6 113412934 missense probably benign 0.31
R2896:Ttll3 UTSW 6 113392722 missense probably benign 0.15
R2903:Ttll3 UTSW 6 113407323 missense probably damaging 0.99
R2906:Ttll3 UTSW 6 113392510 unclassified probably benign
R4659:Ttll3 UTSW 6 113414141 missense probably benign
R4746:Ttll3 UTSW 6 113407392 missense probably damaging 1.00
R4984:Ttll3 UTSW 6 113412940 missense probably benign 0.00
R5358:Ttll3 UTSW 6 113401331 missense probably benign 0.26
R5525:Ttll3 UTSW 6 113412978 missense probably benign
R5548:Ttll3 UTSW 6 113393117 missense probably damaging 1.00
R5694:Ttll3 UTSW 6 113399708 missense probably damaging 1.00
R5993:Ttll3 UTSW 6 113398031 nonsense probably null
R6119:Ttll3 UTSW 6 113394741 missense probably damaging 1.00
R6268:Ttll3 UTSW 6 113392563 missense probably benign 0.00
R6719:Ttll3 UTSW 6 113399032 intron probably benign
R6852:Ttll3 UTSW 6 113399155 frame shift probably null
R6852:Ttll3 UTSW 6 113399157 frame shift probably null
R6852:Ttll3 UTSW 6 113399159 frame shift probably null
R6853:Ttll3 UTSW 6 113399157 frame shift probably null
R6854:Ttll3 UTSW 6 113399157 frame shift probably null
R7170:Ttll3 UTSW 6 113413878 missense probably benign 0.41
R7239:Ttll3 UTSW 6 113399157 frame shift probably null
R7302:Ttll3 UTSW 6 113409285 missense probably damaging 1.00
R7330:Ttll3 UTSW 6 113399157 frame shift probably null
R7330:Ttll3 UTSW 6 113399164 frame shift probably null
R7586:Ttll3 UTSW 6 113399157 frame shift probably null
R7587:Ttll3 UTSW 6 113399157 frame shift probably null
R7701:Ttll3 UTSW 6 113399157 frame shift probably null
R7702:Ttll3 UTSW 6 113399157 frame shift probably null
R7776:Ttll3 UTSW 6 113399159 frame shift probably null
R7793:Ttll3 UTSW 6 113399159 frame shift probably null
R7797:Ttll3 UTSW 6 113394777 missense possibly damaging 0.76
R7824:Ttll3 UTSW 6 113399157 frame shift probably null
R7825:Ttll3 UTSW 6 113399157 frame shift probably null
R7825:Ttll3 UTSW 6 113399159 frame shift probably null
R7826:Ttll3 UTSW 6 113399157 frame shift probably null
R7827:Ttll3 UTSW 6 113399157 frame shift probably null
R7827:Ttll3 UTSW 6 113399162 frame shift probably null
R7831:Ttll3 UTSW 6 113399157 frame shift probably null
R7832:Ttll3 UTSW 6 113399157 frame shift probably null
R7833:Ttll3 UTSW 6 113409337 missense probably damaging 1.00
R7966:Ttll3 UTSW 6 113399157 frame shift probably null
R8344:Ttll3 UTSW 6 113394998 missense probably damaging 1.00
R8418:Ttll3 UTSW 6 113394773 missense probably benign 0.04
R8768:Ttll3 UTSW 6 113408988 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCAATGAATGGTGCGTGTC -3'
(R):5'- AGGGCTCCTGAGTAGAATCATC -3'

Sequencing Primer
(F):5'- GTGCGTGTCACATTTCCTG -3'
(R):5'- CTCCTGAGTAGAATCATCCAGGATAG -3'
Posted On2016-09-06