Incidental Mutation 'R5372:Stard5'
ID428790
Institutional Source Beutler Lab
Gene Symbol Stard5
Ensembl Gene ENSMUSG00000046027
Gene NameStAR-related lipid transfer (START) domain containing 5
Synonyms2310058G22Rik, D7Ertd152e, 18B7-T7(GS)
MMRRC Submission 042948-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5372 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location83631959-83653127 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 83633220 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 80 (D80E)
Ref Sequence ENSEMBL: ENSMUSP00000074872 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075418] [ENSMUST00000117410]
Predicted Effect probably damaging
Transcript: ENSMUST00000075418
AA Change: D80E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000074872
Gene: ENSMUSG00000046027
AA Change: D80E

DomainStartEndE-ValueType
START 7 210 8.57e-10 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000117410
AA Change: D80E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000112781
Gene: ENSMUSG00000046027
AA Change: D80E

DomainStartEndE-ValueType
Pfam:START 7 196 5.9e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130723
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146469
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148687
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150174
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207355
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208892
Meta Mutation Damage Score 0.6011 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 96% (89/93)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Proteins containing a steroidogenic acute regulatory-related lipid transfer (START) domain are often involved in the trafficking of lipids and cholesterol between diverse intracellular membranes. This gene is a member of the StarD subfamily that encodes START-related lipid transfer proteins. The protein encoded by this gene is a cholesterol transporter and is also able to bind and transport other sterol-derived molecules related to the cholesterol/bile acid biosynthetic pathways such as 25-hydroxycholesterol. Its expression is upregulated during endoplasmic reticulum (ER) stress. The protein is thought to act as a cytosolic sterol transporter that moves cholesterol between intracellular membranes such as from the cytoplasm to the ER and from the ER to the Golgi apparatus. Alternative splicing of this gene produces multiple transcript variants. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal vertebral transverse process morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 T A 3: 122,055,339 D108E probably damaging Het
Abhd12b A G 12: 70,181,026 D194G probably damaging Het
Adck5 A G 15: 76,594,507 probably benign Het
Adgrb3 C T 1: 25,128,859 V792I probably benign Het
Anxa8 G A 14: 34,093,911 V174M probably damaging Het
Apol9b A T 15: 77,735,720 R239W probably benign Het
Arhgap26 A G 18: 38,642,456 noncoding transcript Het
Atrnl1 A G 19: 57,755,536 Y1190C probably benign Het
Brinp3 T G 1: 146,831,726 L376R probably damaging Het
Btbd2 A T 10: 80,648,641 M132K probably damaging Het
C130073F10Rik A T 4: 101,890,487 I115K probably damaging Het
C1ra T A 6: 124,521,625 Y426N probably damaging Het
Cacna1b A T 2: 24,733,959 V203E probably damaging Het
Catsperg1 T A 7: 29,210,712 D68V probably benign Het
Ccdc158 A C 5: 92,632,560 S885A possibly damaging Het
Cdc42bpa T C 1: 180,064,979 V236A probably damaging Het
Cdca7 A T 2: 72,482,449 E176D probably damaging Het
Cdk17 A G 10: 93,226,039 D211G probably benign Het
Clca3a2 A C 3: 144,797,525 M888R probably benign Het
Clcn7 T A 17: 25,157,179 M568K possibly damaging Het
Clip1 G T 5: 123,630,240 N811K probably benign Het
Col12a1 T A 9: 79,678,366 Y1243F probably damaging Het
Dctn1 T A 6: 83,190,210 D315E probably damaging Het
Dgcr2 T C 16: 17,872,644 T41A probably benign Het
Dync2h1 G A 9: 7,176,962 probably benign Het
Ep300 A G 15: 81,636,830 I1264V unknown Het
Fam167b A T 4: 129,578,299 L26Q possibly damaging Het
Fam178b T A 1: 36,564,848 I457F possibly damaging Het
Fgd4 A T 16: 16,484,291 N133K probably benign Het
Fndc1 C G 17: 7,765,210 V1295L unknown Het
Gad2 A T 2: 22,690,243 D552V possibly damaging Het
Hars2 T C 18: 36,790,481 Y361H possibly damaging Het
Heca T A 10: 17,915,139 S390C probably damaging Het
Hephl1 G T 9: 15,097,899 Y132* probably null Het
Hormad1 T A 3: 95,576,424 D182E probably damaging Het
Ifna15 G A 4: 88,558,101 P49S probably damaging Het
Khsrp T C 17: 57,024,292 T429A possibly damaging Het
Magi2 A G 5: 20,702,110 Q1094R possibly damaging Het
Map3k11 T A 19: 5,690,962 I239K probably damaging Het
Mtus2 A G 5: 148,313,412 T1319A probably damaging Het
Nup54 A G 5: 92,417,857 I406T probably damaging Het
Nxpe2 T C 9: 48,339,519 T43A possibly damaging Het
Nynrin A G 14: 55,868,491 E889G probably benign Het
Olfr1313 A G 2: 112,072,109 I158T probably benign Het
Olfr160 T C 9: 37,711,938 M114V possibly damaging Het
Olfr301 T A 7: 86,412,968 I202N possibly damaging Het
Olfr663 A G 7: 104,703,795 D76G probably benign Het
Opa1 A C 16: 29,586,119 H45P probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Papola A G 12: 105,827,050 K543R probably benign Het
Plcxd3 G A 15: 4,574,788 V293I probably benign Het
Polr2g T C 19: 8,797,303 Y72C probably damaging Het
Ppp1r21 A G 17: 88,550,675 K205E probably benign Het
Ptpre A G 7: 135,653,940 K53E possibly damaging Het
Rasal3 T C 17: 32,391,344 K990E probably benign Het
Rgs3 A T 4: 62,652,697 probably benign Het
Rhd A G 4: 134,884,632 T254A possibly damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Scube3 G T 17: 28,152,482 C57F probably damaging Het
Sh2d5 A G 4: 138,254,699 D57G possibly damaging Het
Slc12a6 T A 2: 112,347,360 L608* probably null Het
Slk A T 19: 47,625,393 N896I probably damaging Het
Smc6 A G 12: 11,282,430 D211G probably damaging Het
Sox6 A T 7: 115,550,151 Y371* probably null Het
Srcap G A 7: 127,557,613 probably null Het
Supv3l1 C T 10: 62,432,357 V570M probably damaging Het
Syt7 G T 19: 10,426,621 V180L probably damaging Het
Tacc2 T A 7: 130,623,260 H558Q probably benign Het
Tas2r120 T A 6: 132,657,483 M176K possibly damaging Het
Tmem135 A T 7: 89,165,174 probably null Het
Trim35 T C 14: 66,297,266 V66A possibly damaging Het
Tspan12 A G 6: 21,772,699 S284P probably benign Het
Ttll3 A T 6: 113,401,421 K257* probably null Het
Uggt1 C A 1: 36,244,060 probably benign Het
Vmn2r7 T A 3: 64,716,324 I283F probably damaging Het
Wdfy2 T G 14: 62,954,885 H363Q probably damaging Het
Wdr4 T A 17: 31,510,580 K95N probably damaging Het
Zfp141 T C 7: 42,477,196 N91S possibly damaging Het
Zfp383 C T 7: 29,915,270 R317* probably null Het
Other mutations in Stard5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01312:Stard5 APN 7 83633189 missense probably damaging 1.00
IGL02100:Stard5 APN 7 83640445 missense possibly damaging 0.71
IGL03374:Stard5 APN 7 83636772 missense possibly damaging 0.83
R0038:Stard5 UTSW 7 83636743 splice site probably benign
R0038:Stard5 UTSW 7 83636743 splice site probably benign
R0631:Stard5 UTSW 7 83632757 missense probably damaging 1.00
R2170:Stard5 UTSW 7 83633158 missense probably benign 0.01
R2995:Stard5 UTSW 7 83632743 missense probably damaging 1.00
R4616:Stard5 UTSW 7 83633281 intron probably benign
R5628:Stard5 UTSW 7 83633147 missense probably benign 0.30
R7836:Stard5 UTSW 7 83636776 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGTTTTCTGTCAGCAAGTCC -3'
(R):5'- CAGAGACACATTGTTTCCTGC -3'

Sequencing Primer
(F):5'- TTTCTGTCAGCAAGTCCTAGAACCAG -3'
(R):5'- CATTGTTTCCTGCCAGGGACAAG -3'
Posted On2016-09-06