Incidental Mutation 'R5372:Olfr301'
ID428791
Institutional Source Beutler Lab
Gene Symbol Olfr301
Ensembl Gene ENSMUSG00000061549
Gene Nameolfactory receptor 301
SynonymsOlfr1531-ps1, MOR211-8P, GA_x6K02T2NHDJ-9693313-9692378, MOR221-1P, MOR221-1P, MOR221-4
MMRRC Submission 042948-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R5372 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location86403846-86414024 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 86412968 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 202 (I202N)
Ref Sequence ENSEMBL: ENSMUSP00000133780 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000174362]
Predicted Effect possibly damaging
Transcript: ENSMUST00000174362
AA Change: I202N

PolyPhen 2 Score 0.658 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000133780
Gene: ENSMUSG00000061549
AA Change: I202N

DomainStartEndE-ValueType
low complexity region 21 38 N/A INTRINSIC
Pfam:7tm_1 39 289 2e-28 PFAM
Pfam:7tm_4 137 282 1.1e-40 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 96% (89/93)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 T A 3: 122,055,339 D108E probably damaging Het
Abhd12b A G 12: 70,181,026 D194G probably damaging Het
Adck5 A G 15: 76,594,507 probably benign Het
Adgrb3 C T 1: 25,128,859 V792I probably benign Het
Anxa8 G A 14: 34,093,911 V174M probably damaging Het
Apol9b A T 15: 77,735,720 R239W probably benign Het
Arhgap26 A G 18: 38,642,456 noncoding transcript Het
Atrnl1 A G 19: 57,755,536 Y1190C probably benign Het
Brinp3 T G 1: 146,831,726 L376R probably damaging Het
Btbd2 A T 10: 80,648,641 M132K probably damaging Het
C130073F10Rik A T 4: 101,890,487 I115K probably damaging Het
C1ra T A 6: 124,521,625 Y426N probably damaging Het
Cacna1b A T 2: 24,733,959 V203E probably damaging Het
Catsperg1 T A 7: 29,210,712 D68V probably benign Het
Ccdc158 A C 5: 92,632,560 S885A possibly damaging Het
Cdc42bpa T C 1: 180,064,979 V236A probably damaging Het
Cdca7 A T 2: 72,482,449 E176D probably damaging Het
Cdk17 A G 10: 93,226,039 D211G probably benign Het
Clca3a2 A C 3: 144,797,525 M888R probably benign Het
Clcn7 T A 17: 25,157,179 M568K possibly damaging Het
Clip1 G T 5: 123,630,240 N811K probably benign Het
Col12a1 T A 9: 79,678,366 Y1243F probably damaging Het
Dctn1 T A 6: 83,190,210 D315E probably damaging Het
Dgcr2 T C 16: 17,872,644 T41A probably benign Het
Dync2h1 G A 9: 7,176,962 probably benign Het
Ep300 A G 15: 81,636,830 I1264V unknown Het
Fam167b A T 4: 129,578,299 L26Q possibly damaging Het
Fam178b T A 1: 36,564,848 I457F possibly damaging Het
Fgd4 A T 16: 16,484,291 N133K probably benign Het
Fndc1 C G 17: 7,765,210 V1295L unknown Het
Gad2 A T 2: 22,690,243 D552V possibly damaging Het
Hars2 T C 18: 36,790,481 Y361H possibly damaging Het
Heca T A 10: 17,915,139 S390C probably damaging Het
Hephl1 G T 9: 15,097,899 Y132* probably null Het
Hormad1 T A 3: 95,576,424 D182E probably damaging Het
Ifna15 G A 4: 88,558,101 P49S probably damaging Het
Khsrp T C 17: 57,024,292 T429A possibly damaging Het
Magi2 A G 5: 20,702,110 Q1094R possibly damaging Het
Map3k11 T A 19: 5,690,962 I239K probably damaging Het
Mtus2 A G 5: 148,313,412 T1319A probably damaging Het
Nup54 A G 5: 92,417,857 I406T probably damaging Het
Nxpe2 T C 9: 48,339,519 T43A possibly damaging Het
Nynrin A G 14: 55,868,491 E889G probably benign Het
Olfr1313 A G 2: 112,072,109 I158T probably benign Het
Olfr160 T C 9: 37,711,938 M114V possibly damaging Het
Olfr663 A G 7: 104,703,795 D76G probably benign Het
Opa1 A C 16: 29,586,119 H45P probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Papola A G 12: 105,827,050 K543R probably benign Het
Plcxd3 G A 15: 4,574,788 V293I probably benign Het
Polr2g T C 19: 8,797,303 Y72C probably damaging Het
Ppp1r21 A G 17: 88,550,675 K205E probably benign Het
Ptpre A G 7: 135,653,940 K53E possibly damaging Het
Rasal3 T C 17: 32,391,344 K990E probably benign Het
Rgs3 A T 4: 62,652,697 probably benign Het
Rhd A G 4: 134,884,632 T254A possibly damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Scube3 G T 17: 28,152,482 C57F probably damaging Het
Sh2d5 A G 4: 138,254,699 D57G possibly damaging Het
Slc12a6 T A 2: 112,347,360 L608* probably null Het
Slk A T 19: 47,625,393 N896I probably damaging Het
Smc6 A G 12: 11,282,430 D211G probably damaging Het
Sox6 A T 7: 115,550,151 Y371* probably null Het
Srcap G A 7: 127,557,613 probably null Het
Stard5 T A 7: 83,633,220 D80E probably damaging Het
Supv3l1 C T 10: 62,432,357 V570M probably damaging Het
Syt7 G T 19: 10,426,621 V180L probably damaging Het
Tacc2 T A 7: 130,623,260 H558Q probably benign Het
Tas2r120 T A 6: 132,657,483 M176K possibly damaging Het
Tmem135 A T 7: 89,165,174 probably null Het
Trim35 T C 14: 66,297,266 V66A possibly damaging Het
Tspan12 A G 6: 21,772,699 S284P probably benign Het
Ttll3 A T 6: 113,401,421 K257* probably null Het
Uggt1 C A 1: 36,244,060 probably benign Het
Vmn2r7 T A 3: 64,716,324 I283F probably damaging Het
Wdfy2 T G 14: 62,954,885 H363Q probably damaging Het
Wdr4 T A 17: 31,510,580 K95N probably damaging Het
Zfp141 T C 7: 42,477,196 N91S possibly damaging Het
Zfp383 C T 7: 29,915,270 R317* probably null Het
Other mutations in Olfr301
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01015:Olfr301 APN 7 86412790 missense probably damaging 1.00
IGL01459:Olfr301 APN 7 86412551 missense probably damaging 1.00
IGL01538:Olfr301 APN 7 86412959 missense possibly damaging 0.80
IGL01547:Olfr301 APN 7 86412871 missense possibly damaging 0.94
R0918:Olfr301 UTSW 7 86413195 missense probably benign 0.01
R1559:Olfr301 UTSW 7 86412367 missense probably benign 0.00
R1651:Olfr301 UTSW 7 86407870 utr 5 prime probably benign
R2411:Olfr301 UTSW 7 86413082 missense possibly damaging 0.51
R3732:Olfr301 UTSW 7 86412633 missense probably damaging 0.98
R3832:Olfr301 UTSW 7 86413193 missense probably damaging 1.00
R5175:Olfr301 UTSW 7 86413046 missense probably benign 0.00
R5413:Olfr301 UTSW 7 86412467 missense probably benign
R5520:Olfr301 UTSW 7 86412856 missense probably benign 0.02
R5579:Olfr301 UTSW 7 86412726 nonsense probably null
R6037:Olfr301 UTSW 7 86413270 missense probably benign 0.02
R6037:Olfr301 UTSW 7 86413270 missense probably benign 0.02
R7251:Olfr301 UTSW 7 86413001 missense probably benign
R7340:Olfr301 UTSW 7 86412749 missense possibly damaging 0.92
R7860:Olfr301 UTSW 7 86407911 start gained probably benign
R8305:Olfr301 UTSW 7 86412779 missense probably damaging 1.00
R8338:Olfr301 UTSW 7 86412494 missense probably benign 0.14
R8487:Olfr301 UTSW 7 86412439 missense probably benign 0.34
R8799:Olfr301 UTSW 7 86412646 missense probably damaging 1.00
Z1176:Olfr301 UTSW 7 86412698 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- AACCACTGGTTCTGTGTTCAG -3'
(R):5'- CTACTTCTAATGTTACCACTGGAGG -3'

Sequencing Primer
(F):5'- AGATGACACTGGCTTCCCTACTTAG -3'
(R):5'- CTAATGTTACCACTGGAGGTTTTAG -3'
Posted On2016-09-06