Incidental Mutation 'R5372:Dgcr2'
ID428824
Institutional Source Beutler Lab
Gene Symbol Dgcr2
Ensembl Gene ENSMUSG00000003166
Gene NameDiGeorge syndrome critical region gene 2
Synonyms9930034O06Rik, Dgsc, Dgcr2, DGS-C, Lan, Sez12, Idd
MMRRC Submission 042948-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5372 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location17839482-17898562 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 17872644 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 41 (T41A)
Ref Sequence ENSEMBL: ENSMUSP00000115071 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000012152] [ENSMUST00000066127] [ENSMUST00000117082] [ENSMUST00000117945] [ENSMUST00000150068] [ENSMUST00000155943]
Predicted Effect probably benign
Transcript: ENSMUST00000012152
AA Change: T41A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000012152
Gene: ENSMUSG00000003166
AA Change: T41A

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
LDLa 29 68 6.28e-11 SMART
CLECT 114 265 1.06e-14 SMART
VWC 270 331 1.42e-9 SMART
transmembrane domain 345 367 N/A INTRINSIC
low complexity region 369 377 N/A INTRINSIC
low complexity region 438 449 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000066127
AA Change: T41A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000064603
Gene: ENSMUSG00000003166
AA Change: T41A

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
LDLa 29 68 6.28e-11 SMART
CLECT 111 262 1.06e-14 SMART
transmembrane domain 274 296 N/A INTRINSIC
low complexity region 298 306 N/A INTRINSIC
low complexity region 367 378 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117082
AA Change: T41A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000113506
Gene: ENSMUSG00000003166
AA Change: T41A

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
LDLa 29 68 5.86e-11 SMART
CLECT 113 264 1.06e-14 SMART
VWC 269 330 1.42e-9 SMART
transmembrane domain 344 366 N/A INTRINSIC
low complexity region 368 376 N/A INTRINSIC
low complexity region 437 448 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117945
AA Change: T41A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000112783
Gene: ENSMUSG00000003166
AA Change: T41A

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
LDLa 29 68 6.28e-11 SMART
CLECT 111 262 1.06e-14 SMART
VWC 267 328 1.42e-9 SMART
transmembrane domain 342 364 N/A INTRINSIC
low complexity region 366 374 N/A INTRINSIC
low complexity region 435 446 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135229
Predicted Effect probably benign
Transcript: ENSMUST00000150068
AA Change: T41A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000115071
Gene: ENSMUSG00000092470
AA Change: T41A

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
LDLa 29 68 6.28e-11 SMART
CLECT 114 265 1.06e-14 SMART
VWC 270 331 1.42e-9 SMART
transmembrane domain 345 367 N/A INTRINSIC
low complexity region 369 377 N/A INTRINSIC
low complexity region 438 449 N/A INTRINSIC
low complexity region 559 565 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155611
Predicted Effect probably benign
Transcript: ENSMUST00000155943
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231750
Meta Mutation Damage Score 0.0650 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 96% (89/93)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Deletions of the 22q11.2 have been associated with a wide range of developmental defects (notably DiGeorge syndrome, velocardiofacial syndrome, conotruncal anomaly face syndrome and isolated conotruncal cardiac defects) classified under the acronym CATCH 22. The DGCR2 gene encodes a novel putative adhesion receptor protein, which could play a role in neural crest cells migration, a process which has been proposed to be altered in DiGeorge syndrome. Alternative splicing results in multiple transcript variants.[provided by RefSeq, May 2010]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 T A 3: 122,055,339 D108E probably damaging Het
Abhd12b A G 12: 70,181,026 D194G probably damaging Het
Adck5 A G 15: 76,594,507 probably benign Het
Adgrb3 C T 1: 25,128,859 V792I probably benign Het
Anxa8 G A 14: 34,093,911 V174M probably damaging Het
Apol9b A T 15: 77,735,720 R239W probably benign Het
Arhgap26 A G 18: 38,642,456 noncoding transcript Het
Atrnl1 A G 19: 57,755,536 Y1190C probably benign Het
Brinp3 T G 1: 146,831,726 L376R probably damaging Het
Btbd2 A T 10: 80,648,641 M132K probably damaging Het
C130073F10Rik A T 4: 101,890,487 I115K probably damaging Het
C1ra T A 6: 124,521,625 Y426N probably damaging Het
Cacna1b A T 2: 24,733,959 V203E probably damaging Het
Catsperg1 T A 7: 29,210,712 D68V probably benign Het
Ccdc158 A C 5: 92,632,560 S885A possibly damaging Het
Cdc42bpa T C 1: 180,064,979 V236A probably damaging Het
Cdca7 A T 2: 72,482,449 E176D probably damaging Het
Cdk17 A G 10: 93,226,039 D211G probably benign Het
Clca3a2 A C 3: 144,797,525 M888R probably benign Het
Clcn7 T A 17: 25,157,179 M568K possibly damaging Het
Clip1 G T 5: 123,630,240 N811K probably benign Het
Col12a1 T A 9: 79,678,366 Y1243F probably damaging Het
Dctn1 T A 6: 83,190,210 D315E probably damaging Het
Dync2h1 G A 9: 7,176,962 probably benign Het
Ep300 A G 15: 81,636,830 I1264V unknown Het
Fam167b A T 4: 129,578,299 L26Q possibly damaging Het
Fam178b T A 1: 36,564,848 I457F possibly damaging Het
Fgd4 A T 16: 16,484,291 N133K probably benign Het
Fndc1 C G 17: 7,765,210 V1295L unknown Het
Gad2 A T 2: 22,690,243 D552V possibly damaging Het
Hars2 T C 18: 36,790,481 Y361H possibly damaging Het
Heca T A 10: 17,915,139 S390C probably damaging Het
Hephl1 G T 9: 15,097,899 Y132* probably null Het
Hormad1 T A 3: 95,576,424 D182E probably damaging Het
Ifna15 G A 4: 88,558,101 P49S probably damaging Het
Khsrp T C 17: 57,024,292 T429A possibly damaging Het
Magi2 A G 5: 20,702,110 Q1094R possibly damaging Het
Map3k11 T A 19: 5,690,962 I239K probably damaging Het
Mtus2 A G 5: 148,313,412 T1319A probably damaging Het
Nup54 A G 5: 92,417,857 I406T probably damaging Het
Nxpe2 T C 9: 48,339,519 T43A possibly damaging Het
Nynrin A G 14: 55,868,491 E889G probably benign Het
Olfr1313 A G 2: 112,072,109 I158T probably benign Het
Olfr160 T C 9: 37,711,938 M114V possibly damaging Het
Olfr301 T A 7: 86,412,968 I202N possibly damaging Het
Olfr663 A G 7: 104,703,795 D76G probably benign Het
Opa1 A C 16: 29,586,119 H45P probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Papola A G 12: 105,827,050 K543R probably benign Het
Plcxd3 G A 15: 4,574,788 V293I probably benign Het
Polr2g T C 19: 8,797,303 Y72C probably damaging Het
Ppp1r21 A G 17: 88,550,675 K205E probably benign Het
Ptpre A G 7: 135,653,940 K53E possibly damaging Het
Rasal3 T C 17: 32,391,344 K990E probably benign Het
Rgs3 A T 4: 62,652,697 probably benign Het
Rhd A G 4: 134,884,632 T254A possibly damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Scube3 G T 17: 28,152,482 C57F probably damaging Het
Sh2d5 A G 4: 138,254,699 D57G possibly damaging Het
Slc12a6 T A 2: 112,347,360 L608* probably null Het
Slk A T 19: 47,625,393 N896I probably damaging Het
Smc6 A G 12: 11,282,430 D211G probably damaging Het
Sox6 A T 7: 115,550,151 Y371* probably null Het
Srcap G A 7: 127,557,613 probably null Het
Stard5 T A 7: 83,633,220 D80E probably damaging Het
Supv3l1 C T 10: 62,432,357 V570M probably damaging Het
Syt7 G T 19: 10,426,621 V180L probably damaging Het
Tacc2 T A 7: 130,623,260 H558Q probably benign Het
Tas2r120 T A 6: 132,657,483 M176K possibly damaging Het
Tmem135 A T 7: 89,165,174 probably null Het
Trim35 T C 14: 66,297,266 V66A possibly damaging Het
Tspan12 A G 6: 21,772,699 S284P probably benign Het
Ttll3 A T 6: 113,401,421 K257* probably null Het
Uggt1 C A 1: 36,244,060 probably benign Het
Vmn2r7 T A 3: 64,716,324 I283F probably damaging Het
Wdfy2 T G 14: 62,954,885 H363Q probably damaging Het
Wdr4 T A 17: 31,510,580 K95N probably damaging Het
Zfp141 T C 7: 42,477,196 N91S possibly damaging Het
Zfp383 C T 7: 29,915,270 R317* probably null Het
Other mutations in Dgcr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
capitol UTSW 16 17845080 nonsense probably null
R0135:Dgcr2 UTSW 16 17858442 missense probably damaging 0.99
R0218:Dgcr2 UTSW 16 17849786 missense probably damaging 1.00
R0627:Dgcr2 UTSW 16 17844008 missense probably damaging 1.00
R1450:Dgcr2 UTSW 16 17856814 missense possibly damaging 0.71
R1769:Dgcr2 UTSW 16 17857251 splice site probably benign
R1836:Dgcr2 UTSW 16 17849720 missense probably damaging 1.00
R2152:Dgcr2 UTSW 16 17891487 splice site probably null
R2259:Dgcr2 UTSW 16 17844977 splice site probably null
R4815:Dgcr2 UTSW 16 17858619 intron probably benign
R4829:Dgcr2 UTSW 16 17842753 missense possibly damaging 0.90
R5931:Dgcr2 UTSW 16 17857309 missense possibly damaging 0.71
R7008:Dgcr2 UTSW 16 17845001 missense probably damaging 1.00
R7285:Dgcr2 UTSW 16 17845080 nonsense probably null
R7915:Dgcr2 UTSW 16 17859402 critical splice donor site probably null
R8099:Dgcr2 UTSW 16 17849769 missense probably damaging 1.00
R8120:Dgcr2 UTSW 16 17857319 nonsense probably null
R8307:Dgcr2 UTSW 16 17858378 missense probably benign 0.00
R8308:Dgcr2 UTSW 16 17858378 missense probably benign 0.00
R8837:Dgcr2 UTSW 16 17849766 missense possibly damaging 0.69
R8851:Dgcr2 UTSW 16 17872643 missense possibly damaging 0.46
Predicted Primers PCR Primer
(F):5'- GTGGGTCAACTCACACTACC -3'
(R):5'- TATTTTGGGAGCATGCTCAGACC -3'

Sequencing Primer
(F):5'- TACCCTTCCAATGTGTACAGAC -3'
(R):5'- ATGCTCAGACCCTGCTGAG -3'
Posted On2016-09-06