Incidental Mutation 'R5372:Clcn7'
ID428827
Institutional Source Beutler Lab
Gene Symbol Clcn7
Ensembl Gene ENSMUSG00000036636
Gene Namechloride channel, voltage-sensitive 7
SynonymsClC-7
MMRRC Submission 042948-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5372 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location25133391-25162104 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 25157179 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 568 (M568K)
Ref Sequence ENSEMBL: ENSMUSP00000035964 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040729] [ENSMUST00000160961]
Predicted Effect possibly damaging
Transcript: ENSMUST00000040729
AA Change: M568K

PolyPhen 2 Score 0.819 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000035964
Gene: ENSMUSG00000036636
AA Change: M568K

DomainStartEndE-ValueType
low complexity region 60 74 N/A INTRINSIC
Pfam:Voltage_CLC 183 594 1.5e-96 PFAM
CBS 632 687 8.38e-4 SMART
CBS 742 790 1.77e-11 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159426
Predicted Effect possibly damaging
Transcript: ENSMUST00000160961
AA Change: M548K

PolyPhen 2 Score 0.465 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000124194
Gene: ENSMUSG00000036636
AA Change: M548K

DomainStartEndE-ValueType
low complexity region 8 25 N/A INTRINSIC
low complexity region 40 54 N/A INTRINSIC
Pfam:Voltage_CLC 163 574 1.5e-93 PFAM
CBS 612 667 8.38e-4 SMART
CBS 722 770 1.77e-11 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161153
Predicted Effect unknown
Transcript: ENSMUST00000162862
AA Change: M280K
SMART Domains Protein: ENSMUSP00000124527
Gene: ENSMUSG00000036636
AA Change: M280K

DomainStartEndE-ValueType
Pfam:Voltage_CLC 5 307 1.3e-48 PFAM
Meta Mutation Damage Score 0.9047 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 96% (89/93)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the CLC chloride channel family of proteins. Chloride channels play important roles in the plasma membrane and in intracellular organelles. This gene encodes chloride channel 7. Defects in this gene are the cause of osteopetrosis autosomal recessive type 4 (OPTB4), also called infantile malignant osteopetrosis type 2 as well as the cause of autosomal dominant osteopetrosis type 2 (OPTA2), also called autosomal dominant Albers-Schonberg disease or marble disease autosoml dominant. Osteopetrosis is a rare genetic disease characterized by abnormally dense bone, due to defective resorption of immature bone. OPTA2 is the most common form of osteopetrosis, occurring in adolescence or adulthood. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit postnatal lethality, abnormal bone formation, including osteopetrosis, and retinal degeneration. Mice homozygous for a conditional allele exhibit lysosomal defects with neuronal degeneration and accumulationof giant lysosomes in renal tubule cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 T A 3: 122,055,339 D108E probably damaging Het
Abhd12b A G 12: 70,181,026 D194G probably damaging Het
Adck5 A G 15: 76,594,507 probably benign Het
Adgrb3 C T 1: 25,128,859 V792I probably benign Het
Anxa8 G A 14: 34,093,911 V174M probably damaging Het
Apol9b A T 15: 77,735,720 R239W probably benign Het
Arhgap26 A G 18: 38,642,456 noncoding transcript Het
Atrnl1 A G 19: 57,755,536 Y1190C probably benign Het
Brinp3 T G 1: 146,831,726 L376R probably damaging Het
Btbd2 A T 10: 80,648,641 M132K probably damaging Het
C130073F10Rik A T 4: 101,890,487 I115K probably damaging Het
C1ra T A 6: 124,521,625 Y426N probably damaging Het
Cacna1b A T 2: 24,733,959 V203E probably damaging Het
Catsperg1 T A 7: 29,210,712 D68V probably benign Het
Ccdc158 A C 5: 92,632,560 S885A possibly damaging Het
Cdc42bpa T C 1: 180,064,979 V236A probably damaging Het
Cdca7 A T 2: 72,482,449 E176D probably damaging Het
Cdk17 A G 10: 93,226,039 D211G probably benign Het
Clca3a2 A C 3: 144,797,525 M888R probably benign Het
Clip1 G T 5: 123,630,240 N811K probably benign Het
Col12a1 T A 9: 79,678,366 Y1243F probably damaging Het
Dctn1 T A 6: 83,190,210 D315E probably damaging Het
Dgcr2 T C 16: 17,872,644 T41A probably benign Het
Dync2h1 G A 9: 7,176,962 probably benign Het
Ep300 A G 15: 81,636,830 I1264V unknown Het
Fam167b A T 4: 129,578,299 L26Q possibly damaging Het
Fam178b T A 1: 36,564,848 I457F possibly damaging Het
Fgd4 A T 16: 16,484,291 N133K probably benign Het
Fndc1 C G 17: 7,765,210 V1295L unknown Het
Gad2 A T 2: 22,690,243 D552V possibly damaging Het
Hars2 T C 18: 36,790,481 Y361H possibly damaging Het
Heca T A 10: 17,915,139 S390C probably damaging Het
Hephl1 G T 9: 15,097,899 Y132* probably null Het
Hormad1 T A 3: 95,576,424 D182E probably damaging Het
Ifna15 G A 4: 88,558,101 P49S probably damaging Het
Khsrp T C 17: 57,024,292 T429A possibly damaging Het
Magi2 A G 5: 20,702,110 Q1094R possibly damaging Het
Map3k11 T A 19: 5,690,962 I239K probably damaging Het
Mtus2 A G 5: 148,313,412 T1319A probably damaging Het
Nup54 A G 5: 92,417,857 I406T probably damaging Het
Nxpe2 T C 9: 48,339,519 T43A possibly damaging Het
Nynrin A G 14: 55,868,491 E889G probably benign Het
Olfr1313 A G 2: 112,072,109 I158T probably benign Het
Olfr160 T C 9: 37,711,938 M114V possibly damaging Het
Olfr301 T A 7: 86,412,968 I202N possibly damaging Het
Olfr663 A G 7: 104,703,795 D76G probably benign Het
Opa1 A C 16: 29,586,119 H45P probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Papola A G 12: 105,827,050 K543R probably benign Het
Plcxd3 G A 15: 4,574,788 V293I probably benign Het
Polr2g T C 19: 8,797,303 Y72C probably damaging Het
Ppp1r21 A G 17: 88,550,675 K205E probably benign Het
Ptpre A G 7: 135,653,940 K53E possibly damaging Het
Rasal3 T C 17: 32,391,344 K990E probably benign Het
Rgs3 A T 4: 62,652,697 probably benign Het
Rhd A G 4: 134,884,632 T254A possibly damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Scube3 G T 17: 28,152,482 C57F probably damaging Het
Sh2d5 A G 4: 138,254,699 D57G possibly damaging Het
Slc12a6 T A 2: 112,347,360 L608* probably null Het
Slk A T 19: 47,625,393 N896I probably damaging Het
Smc6 A G 12: 11,282,430 D211G probably damaging Het
Sox6 A T 7: 115,550,151 Y371* probably null Het
Srcap G A 7: 127,557,613 probably null Het
Stard5 T A 7: 83,633,220 D80E probably damaging Het
Supv3l1 C T 10: 62,432,357 V570M probably damaging Het
Syt7 G T 19: 10,426,621 V180L probably damaging Het
Tacc2 T A 7: 130,623,260 H558Q probably benign Het
Tas2r120 T A 6: 132,657,483 M176K possibly damaging Het
Tmem135 A T 7: 89,165,174 probably null Het
Trim35 T C 14: 66,297,266 V66A possibly damaging Het
Tspan12 A G 6: 21,772,699 S284P probably benign Het
Ttll3 A T 6: 113,401,421 K257* probably null Het
Uggt1 C A 1: 36,244,060 probably benign Het
Vmn2r7 T A 3: 64,716,324 I283F probably damaging Het
Wdfy2 T G 14: 62,954,885 H363Q probably damaging Het
Wdr4 T A 17: 31,510,580 K95N probably damaging Het
Zfp141 T C 7: 42,477,196 N91S possibly damaging Het
Zfp383 C T 7: 29,915,270 R317* probably null Het
Other mutations in Clcn7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00486:Clcn7 APN 17 25151123 missense probably damaging 1.00
IGL01735:Clcn7 APN 17 25151116 missense probably benign 0.13
IGL01912:Clcn7 APN 17 25153009 splice site probably benign
IGL01936:Clcn7 APN 17 25155376 missense probably benign 0.44
IGL02084:Clcn7 APN 17 25157925 missense probably benign
IGL02121:Clcn7 APN 17 25153084 missense possibly damaging 0.95
IGL02160:Clcn7 APN 17 25149030 unclassified probably benign
IGL02335:Clcn7 APN 17 25146847 missense probably benign 0.00
IGL02507:Clcn7 APN 17 25144469 missense probably damaging 1.00
IGL02605:Clcn7 APN 17 25146818 missense possibly damaging 0.60
IGL03160:Clcn7 APN 17 25146453 unclassified probably benign
IGL03192:Clcn7 APN 17 25133601 missense probably benign 0.00
IGL03194:Clcn7 APN 17 25150548 missense probably damaging 0.98
IGL03409:Clcn7 APN 17 25155385 missense probably damaging 1.00
R0140:Clcn7 UTSW 17 25153754 missense probably damaging 1.00
R0153:Clcn7 UTSW 17 25149202 unclassified probably benign
R0970:Clcn7 UTSW 17 25151234 critical splice donor site probably null
R1644:Clcn7 UTSW 17 25159698 missense probably damaging 1.00
R1856:Clcn7 UTSW 17 25160471 missense probably damaging 1.00
R2145:Clcn7 UTSW 17 25144451 missense probably benign
R2173:Clcn7 UTSW 17 25145609 missense probably benign
R2401:Clcn7 UTSW 17 25153140 missense probably benign 0.02
R2511:Clcn7 UTSW 17 25155446 missense probably damaging 1.00
R3683:Clcn7 UTSW 17 25150593 missense possibly damaging 0.84
R3684:Clcn7 UTSW 17 25150593 missense possibly damaging 0.84
R3694:Clcn7 UTSW 17 25159707 missense probably damaging 0.99
R4424:Clcn7 UTSW 17 25160176 missense probably damaging 1.00
R4681:Clcn7 UTSW 17 25157961 missense probably damaging 1.00
R4870:Clcn7 UTSW 17 25153565 intron probably benign
R5820:Clcn7 UTSW 17 25149052 missense probably damaging 1.00
R6154:Clcn7 UTSW 17 25157954 missense probably damaging 0.98
R6181:Clcn7 UTSW 17 25151728 missense possibly damaging 0.79
R6306:Clcn7 UTSW 17 25157528 missense probably benign 0.01
R6798:Clcn7 UTSW 17 25159760 missense probably damaging 1.00
R6961:Clcn7 UTSW 17 25157214 missense probably damaging 1.00
R7020:Clcn7 UTSW 17 25146351 missense possibly damaging 0.76
R7089:Clcn7 UTSW 17 25153693 missense
R7757:Clcn7 UTSW 17 25156822 missense probably damaging 1.00
R8057:Clcn7 UTSW 17 25149259 nonsense probably null
R8670:Clcn7 UTSW 17 25159614 missense probably damaging 0.99
X0020:Clcn7 UTSW 17 25150226 missense probably damaging 1.00
Z1177:Clcn7 UTSW 17 25153015 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- GTCATCAGGTCCATAGCACG -3'
(R):5'- ATGACTCAATGGGCTCCCTTC -3'

Sequencing Primer
(F):5'- AGGTCCATAGCACGGCCTG -3'
(R):5'- AATGGGCTCCCTTCCTTCTG -3'
Posted On2016-09-06