Incidental Mutation 'R5372:Map3k11'
ID428834
Institutional Source Beutler Lab
Gene Symbol Map3k11
Ensembl Gene ENSMUSG00000004054
Gene Namemitogen-activated protein kinase kinase kinase 11
SynonymsMlk3, 2610017K16Rik
MMRRC Submission 042948-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.394) question?
Stock #R5372 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location5689131-5702862 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 5690962 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 239 (I239K)
Ref Sequence ENSEMBL: ENSMUSP00000004156 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004156] [ENSMUST00000068169] [ENSMUST00000113615]
Predicted Effect probably damaging
Transcript: ENSMUST00000004156
AA Change: I239K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000004156
Gene: ENSMUSG00000004054
AA Change: I239K

DomainStartEndE-ValueType
low complexity region 11 36 N/A INTRINSIC
SH3 45 105 6.79e-19 SMART
TyrKc 118 377 6.83e-81 SMART
coiled coil region 398 444 N/A INTRINSIC
low complexity region 467 476 N/A INTRINSIC
low complexity region 593 610 N/A INTRINSIC
low complexity region 614 632 N/A INTRINSIC
low complexity region 676 697 N/A INTRINSIC
low complexity region 759 778 N/A INTRINSIC
low complexity region 786 805 N/A INTRINSIC
low complexity region 809 820 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000068169
SMART Domains Protein: ENSMUSP00000063786
Gene: ENSMUSG00000054874

DomainStartEndE-ValueType
transmembrane domain 36 53 N/A INTRINSIC
transmembrane domain 57 79 N/A INTRINSIC
low complexity region 99 111 N/A INTRINSIC
low complexity region 370 376 N/A INTRINSIC
transmembrane domain 385 407 N/A INTRINSIC
transmembrane domain 411 428 N/A INTRINSIC
transmembrane domain 441 463 N/A INTRINSIC
transmembrane domain 473 492 N/A INTRINSIC
transmembrane domain 501 523 N/A INTRINSIC
transmembrane domain 538 560 N/A INTRINSIC
transmembrane domain 573 592 N/A INTRINSIC
transmembrane domain 645 667 N/A INTRINSIC
transmembrane domain 669 691 N/A INTRINSIC
low complexity region 1011 1025 N/A INTRINSIC
Pfam:Pecanex_C 1159 1389 7.5e-124 PFAM
low complexity region 1462 1479 N/A INTRINSIC
low complexity region 1481 1510 N/A INTRINSIC
low complexity region 1525 1538 N/A INTRINSIC
low complexity region 1558 1569 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113615
SMART Domains Protein: ENSMUSP00000109245
Gene: ENSMUSG00000054874

DomainStartEndE-ValueType
transmembrane domain 36 53 N/A INTRINSIC
transmembrane domain 57 79 N/A INTRINSIC
low complexity region 99 111 N/A INTRINSIC
low complexity region 438 459 N/A INTRINSIC
low complexity region 778 784 N/A INTRINSIC
transmembrane domain 793 815 N/A INTRINSIC
transmembrane domain 819 836 N/A INTRINSIC
transmembrane domain 849 871 N/A INTRINSIC
transmembrane domain 881 900 N/A INTRINSIC
transmembrane domain 909 931 N/A INTRINSIC
transmembrane domain 946 968 N/A INTRINSIC
transmembrane domain 981 1000 N/A INTRINSIC
transmembrane domain 1053 1075 N/A INTRINSIC
transmembrane domain 1077 1099 N/A INTRINSIC
low complexity region 1419 1433 N/A INTRINSIC
Pfam:Pecanex_C 1570 1796 5.9e-116 PFAM
low complexity region 1870 1887 N/A INTRINSIC
low complexity region 1889 1918 N/A INTRINSIC
low complexity region 1933 1946 N/A INTRINSIC
low complexity region 1966 1977 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135119
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 96% (89/93)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the serine/threonine kinase family. This kinase contains a SH3 domain and a leucine zipper-basic motif. This kinase preferentially activates MAPK8/JNK kinase, and functions as a positive regulator of JNK signaling pathway. This kinase can directly phosphorylate, and activates IkappaB kinase alpha and beta, and is found to be involved in the transcription activity of NF-kappaB mediated by Rho family GTPases and CDC42. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted or spontaneous mutation display a pattern of dark red stripes of thin dorsal epithelium during pre-wean development, and necrotic dental pulp has been reported for the spontaneous mutant. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 T A 3: 122,055,339 D108E probably damaging Het
Abhd12b A G 12: 70,181,026 D194G probably damaging Het
Adck5 A G 15: 76,594,507 probably benign Het
Adgrb3 C T 1: 25,128,859 V792I probably benign Het
Anxa8 G A 14: 34,093,911 V174M probably damaging Het
Apol9b A T 15: 77,735,720 R239W probably benign Het
Arhgap26 A G 18: 38,642,456 noncoding transcript Het
Atrnl1 A G 19: 57,755,536 Y1190C probably benign Het
Brinp3 T G 1: 146,831,726 L376R probably damaging Het
Btbd2 A T 10: 80,648,641 M132K probably damaging Het
C130073F10Rik A T 4: 101,890,487 I115K probably damaging Het
C1ra T A 6: 124,521,625 Y426N probably damaging Het
Cacna1b A T 2: 24,733,959 V203E probably damaging Het
Catsperg1 T A 7: 29,210,712 D68V probably benign Het
Ccdc158 A C 5: 92,632,560 S885A possibly damaging Het
Cdc42bpa T C 1: 180,064,979 V236A probably damaging Het
Cdca7 A T 2: 72,482,449 E176D probably damaging Het
Cdk17 A G 10: 93,226,039 D211G probably benign Het
Clca3a2 A C 3: 144,797,525 M888R probably benign Het
Clcn7 T A 17: 25,157,179 M568K possibly damaging Het
Clip1 G T 5: 123,630,240 N811K probably benign Het
Col12a1 T A 9: 79,678,366 Y1243F probably damaging Het
Dctn1 T A 6: 83,190,210 D315E probably damaging Het
Dgcr2 T C 16: 17,872,644 T41A probably benign Het
Dync2h1 G A 9: 7,176,962 probably benign Het
Ep300 A G 15: 81,636,830 I1264V unknown Het
Fam167b A T 4: 129,578,299 L26Q possibly damaging Het
Fam178b T A 1: 36,564,848 I457F possibly damaging Het
Fgd4 A T 16: 16,484,291 N133K probably benign Het
Fndc1 C G 17: 7,765,210 V1295L unknown Het
Gad2 A T 2: 22,690,243 D552V possibly damaging Het
Hars2 T C 18: 36,790,481 Y361H possibly damaging Het
Heca T A 10: 17,915,139 S390C probably damaging Het
Hephl1 G T 9: 15,097,899 Y132* probably null Het
Hormad1 T A 3: 95,576,424 D182E probably damaging Het
Ifna15 G A 4: 88,558,101 P49S probably damaging Het
Khsrp T C 17: 57,024,292 T429A possibly damaging Het
Magi2 A G 5: 20,702,110 Q1094R possibly damaging Het
Mtus2 A G 5: 148,313,412 T1319A probably damaging Het
Nup54 A G 5: 92,417,857 I406T probably damaging Het
Nxpe2 T C 9: 48,339,519 T43A possibly damaging Het
Nynrin A G 14: 55,868,491 E889G probably benign Het
Olfr1313 A G 2: 112,072,109 I158T probably benign Het
Olfr160 T C 9: 37,711,938 M114V possibly damaging Het
Olfr301 T A 7: 86,412,968 I202N possibly damaging Het
Olfr663 A G 7: 104,703,795 D76G probably benign Het
Opa1 A C 16: 29,586,119 H45P probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Papola A G 12: 105,827,050 K543R probably benign Het
Plcxd3 G A 15: 4,574,788 V293I probably benign Het
Polr2g T C 19: 8,797,303 Y72C probably damaging Het
Ppp1r21 A G 17: 88,550,675 K205E probably benign Het
Ptpre A G 7: 135,653,940 K53E possibly damaging Het
Rasal3 T C 17: 32,391,344 K990E probably benign Het
Rgs3 A T 4: 62,652,697 probably benign Het
Rhd A G 4: 134,884,632 T254A possibly damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Scube3 G T 17: 28,152,482 C57F probably damaging Het
Sh2d5 A G 4: 138,254,699 D57G possibly damaging Het
Slc12a6 T A 2: 112,347,360 L608* probably null Het
Slk A T 19: 47,625,393 N896I probably damaging Het
Smc6 A G 12: 11,282,430 D211G probably damaging Het
Sox6 A T 7: 115,550,151 Y371* probably null Het
Srcap G A 7: 127,557,613 probably null Het
Stard5 T A 7: 83,633,220 D80E probably damaging Het
Supv3l1 C T 10: 62,432,357 V570M probably damaging Het
Syt7 G T 19: 10,426,621 V180L probably damaging Het
Tacc2 T A 7: 130,623,260 H558Q probably benign Het
Tas2r120 T A 6: 132,657,483 M176K possibly damaging Het
Tmem135 A T 7: 89,165,174 probably null Het
Trim35 T C 14: 66,297,266 V66A possibly damaging Het
Tspan12 A G 6: 21,772,699 S284P probably benign Het
Ttll3 A T 6: 113,401,421 K257* probably null Het
Uggt1 C A 1: 36,244,060 probably benign Het
Vmn2r7 T A 3: 64,716,324 I283F probably damaging Het
Wdfy2 T G 14: 62,954,885 H363Q probably damaging Het
Wdr4 T A 17: 31,510,580 K95N probably damaging Het
Zfp141 T C 7: 42,477,196 N91S possibly damaging Het
Zfp383 C T 7: 29,915,270 R317* probably null Het
Other mutations in Map3k11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02017:Map3k11 APN 19 5697623 missense possibly damaging 0.91
IGL02581:Map3k11 APN 19 5700806 missense probably benign
R0130:Map3k11 UTSW 19 5690815 missense probably damaging 1.00
R0193:Map3k11 UTSW 19 5695846 missense probably damaging 0.99
R1621:Map3k11 UTSW 19 5690806 missense probably damaging 1.00
R1736:Map3k11 UTSW 19 5697401 missense probably benign 0.34
R1791:Map3k11 UTSW 19 5695572 nonsense probably null
R3500:Map3k11 UTSW 19 5690247 start codon destroyed probably benign 0.08
R3836:Map3k11 UTSW 19 5690803 missense possibly damaging 0.71
R3892:Map3k11 UTSW 19 5702283 missense probably benign 0.13
R4303:Map3k11 UTSW 19 5690824 missense probably damaging 1.00
R4513:Map3k11 UTSW 19 5702210 missense probably damaging 0.97
R4613:Map3k11 UTSW 19 5697470 missense probably benign 0.18
R4613:Map3k11 UTSW 19 5697471 missense probably damaging 0.98
R4631:Map3k11 UTSW 19 5690913 missense probably benign 0.30
R4780:Map3k11 UTSW 19 5690938 missense probably damaging 0.99
R5213:Map3k11 UTSW 19 5690641 missense probably damaging 0.99
R5266:Map3k11 UTSW 19 5700594 missense probably benign 0.03
R5736:Map3k11 UTSW 19 5696711 missense probably damaging 1.00
R5899:Map3k11 UTSW 19 5695909 critical splice donor site probably null
R6052:Map3k11 UTSW 19 5697402 missense probably benign 0.01
R6388:Map3k11 UTSW 19 5690251 missense probably damaging 0.96
R6623:Map3k11 UTSW 19 5695603 missense probably damaging 0.97
R6975:Map3k11 UTSW 19 5690727 missense possibly damaging 0.91
R7309:Map3k11 UTSW 19 5690458 missense probably damaging 0.99
R7771:Map3k11 UTSW 19 5690608 missense probably damaging 0.99
R7815:Map3k11 UTSW 19 5695639 missense possibly damaging 0.89
X0025:Map3k11 UTSW 19 5696195 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TGGCCCATCCCAACATCATTG -3'
(R):5'- TGATAGGCCACGGGTATTCC -3'

Sequencing Primer
(F):5'- ATTGCCCTCAAAGCTGTGTG -3'
(R):5'- GGTATTCCCTGGACATCTAATACTC -3'
Posted On2016-09-06