Incidental Mutation 'R5372:Syt7'
ID428836
Institutional Source Beutler Lab
Gene Symbol Syt7
Ensembl Gene ENSMUSG00000024743
Gene Namesynaptotagmin VII
Synonyms
MMRRC Submission 042948-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5372 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location10389090-10453181 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 10426621 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 180 (V180L)
Ref Sequence ENSEMBL: ENSMUSP00000127973 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073899] [ENSMUST00000076968] [ENSMUST00000169121] [ENSMUST00000223586] [ENSMUST00000224135] [ENSMUST00000225452]
Predicted Effect probably benign
Transcript: ENSMUST00000073899
SMART Domains Protein: ENSMUSP00000073560
Gene: ENSMUSG00000024743

DomainStartEndE-ValueType
transmembrane domain 18 40 N/A INTRINSIC
C2 151 254 3.29e-25 SMART
low complexity region 261 274 N/A INTRINSIC
C2 282 396 4.98e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000076968
AA Change: V224L

PolyPhen 2 Score 0.083 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000076234
Gene: ENSMUSG00000024743
AA Change: V224L

DomainStartEndE-ValueType
transmembrane domain 18 40 N/A INTRINSIC
C2 195 298 3.29e-25 SMART
low complexity region 305 318 N/A INTRINSIC
C2 326 440 4.98e-25 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000169121
AA Change: V180L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000127973
Gene: ENSMUSG00000024743
AA Change: V180L

DomainStartEndE-ValueType
transmembrane domain 17 39 N/A INTRINSIC
low complexity region 104 121 N/A INTRINSIC
C2 315 418 3.29e-25 SMART
low complexity region 425 438 N/A INTRINSIC
C2 446 560 4.98e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000223586
Predicted Effect probably benign
Transcript: ENSMUST00000224135
AA Change: V131L

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225019
Predicted Effect probably benign
Transcript: ENSMUST00000225452
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225861
Meta Mutation Damage Score 0.0885 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 96% (89/93)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the synaptotagmin gene family and encodes a protein similar to other family members that mediate calcium-dependent regulation of membrane trafficking in synaptic transmission. A similar protein in rodents mediates hormone secretion and lysosome exocytosis. In humans, expression of this gene has been associated with prostate cancer. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for disruptions in this gene have no gross abnormalities or obvious neurological defects. They do develop fibrosis in the skin and skeletal muscle over time. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 T A 3: 122,055,339 D108E probably damaging Het
Abhd12b A G 12: 70,181,026 D194G probably damaging Het
Adck5 A G 15: 76,594,507 probably benign Het
Adgrb3 C T 1: 25,128,859 V792I probably benign Het
Anxa8 G A 14: 34,093,911 V174M probably damaging Het
Apol9b A T 15: 77,735,720 R239W probably benign Het
Arhgap26 A G 18: 38,642,456 noncoding transcript Het
Atrnl1 A G 19: 57,755,536 Y1190C probably benign Het
Brinp3 T G 1: 146,831,726 L376R probably damaging Het
Btbd2 A T 10: 80,648,641 M132K probably damaging Het
C130073F10Rik A T 4: 101,890,487 I115K probably damaging Het
C1ra T A 6: 124,521,625 Y426N probably damaging Het
Cacna1b A T 2: 24,733,959 V203E probably damaging Het
Catsperg1 T A 7: 29,210,712 D68V probably benign Het
Ccdc158 A C 5: 92,632,560 S885A possibly damaging Het
Cdc42bpa T C 1: 180,064,979 V236A probably damaging Het
Cdca7 A T 2: 72,482,449 E176D probably damaging Het
Cdk17 A G 10: 93,226,039 D211G probably benign Het
Clca3a2 A C 3: 144,797,525 M888R probably benign Het
Clcn7 T A 17: 25,157,179 M568K possibly damaging Het
Clip1 G T 5: 123,630,240 N811K probably benign Het
Col12a1 T A 9: 79,678,366 Y1243F probably damaging Het
Dctn1 T A 6: 83,190,210 D315E probably damaging Het
Dgcr2 T C 16: 17,872,644 T41A probably benign Het
Dync2h1 G A 9: 7,176,962 probably benign Het
Ep300 A G 15: 81,636,830 I1264V unknown Het
Fam167b A T 4: 129,578,299 L26Q possibly damaging Het
Fam178b T A 1: 36,564,848 I457F possibly damaging Het
Fgd4 A T 16: 16,484,291 N133K probably benign Het
Fndc1 C G 17: 7,765,210 V1295L unknown Het
Gad2 A T 2: 22,690,243 D552V possibly damaging Het
Hars2 T C 18: 36,790,481 Y361H possibly damaging Het
Heca T A 10: 17,915,139 S390C probably damaging Het
Hephl1 G T 9: 15,097,899 Y132* probably null Het
Hormad1 T A 3: 95,576,424 D182E probably damaging Het
Ifna15 G A 4: 88,558,101 P49S probably damaging Het
Khsrp T C 17: 57,024,292 T429A possibly damaging Het
Magi2 A G 5: 20,702,110 Q1094R possibly damaging Het
Map3k11 T A 19: 5,690,962 I239K probably damaging Het
Mtus2 A G 5: 148,313,412 T1319A probably damaging Het
Nup54 A G 5: 92,417,857 I406T probably damaging Het
Nxpe2 T C 9: 48,339,519 T43A possibly damaging Het
Nynrin A G 14: 55,868,491 E889G probably benign Het
Olfr1313 A G 2: 112,072,109 I158T probably benign Het
Olfr160 T C 9: 37,711,938 M114V possibly damaging Het
Olfr301 T A 7: 86,412,968 I202N possibly damaging Het
Olfr663 A G 7: 104,703,795 D76G probably benign Het
Opa1 A C 16: 29,586,119 H45P probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Papola A G 12: 105,827,050 K543R probably benign Het
Plcxd3 G A 15: 4,574,788 V293I probably benign Het
Polr2g T C 19: 8,797,303 Y72C probably damaging Het
Ppp1r21 A G 17: 88,550,675 K205E probably benign Het
Ptpre A G 7: 135,653,940 K53E possibly damaging Het
Rasal3 T C 17: 32,391,344 K990E probably benign Het
Rgs3 A T 4: 62,652,697 probably benign Het
Rhd A G 4: 134,884,632 T254A possibly damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Scube3 G T 17: 28,152,482 C57F probably damaging Het
Sh2d5 A G 4: 138,254,699 D57G possibly damaging Het
Slc12a6 T A 2: 112,347,360 L608* probably null Het
Slk A T 19: 47,625,393 N896I probably damaging Het
Smc6 A G 12: 11,282,430 D211G probably damaging Het
Sox6 A T 7: 115,550,151 Y371* probably null Het
Srcap G A 7: 127,557,613 probably null Het
Stard5 T A 7: 83,633,220 D80E probably damaging Het
Supv3l1 C T 10: 62,432,357 V570M probably damaging Het
Tacc2 T A 7: 130,623,260 H558Q probably benign Het
Tas2r120 T A 6: 132,657,483 M176K possibly damaging Het
Tmem135 A T 7: 89,165,174 probably null Het
Trim35 T C 14: 66,297,266 V66A possibly damaging Het
Tspan12 A G 6: 21,772,699 S284P probably benign Het
Ttll3 A T 6: 113,401,421 K257* probably null Het
Uggt1 C A 1: 36,244,060 probably benign Het
Vmn2r7 T A 3: 64,716,324 I283F probably damaging Het
Wdfy2 T G 14: 62,954,885 H363Q probably damaging Het
Wdr4 T A 17: 31,510,580 K95N probably damaging Het
Zfp141 T C 7: 42,477,196 N91S possibly damaging Het
Zfp383 C T 7: 29,915,270 R317* probably null Het
Other mutations in Syt7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01956:Syt7 APN 19 10443391 missense probably benign 0.03
R0412:Syt7 UTSW 19 10444080 nonsense probably null
R1068:Syt7 UTSW 19 10444011 missense probably benign 0.01
R1793:Syt7 UTSW 19 10443990 missense probably damaging 1.00
R1955:Syt7 UTSW 19 10418038 missense probably damaging 1.00
R2049:Syt7 UTSW 19 10439213 missense probably benign 0.28
R2170:Syt7 UTSW 19 10439380 missense probably damaging 1.00
R2911:Syt7 UTSW 19 10443435 missense probably benign 0.00
R3694:Syt7 UTSW 19 10435636 missense possibly damaging 0.69
R4330:Syt7 UTSW 19 10421798 missense probably damaging 1.00
R4573:Syt7 UTSW 19 10439212 nonsense probably null
R4691:Syt7 UTSW 19 10426481 missense probably damaging 0.98
R4732:Syt7 UTSW 19 10442924 missense probably damaging 1.00
R4733:Syt7 UTSW 19 10442924 missense probably damaging 1.00
R4811:Syt7 UTSW 19 10435567 missense probably damaging 0.98
R5067:Syt7 UTSW 19 10442858 missense possibly damaging 0.58
R5069:Syt7 UTSW 19 10439237 missense probably benign 0.00
R5071:Syt7 UTSW 19 10443428 missense possibly damaging 0.92
R5830:Syt7 UTSW 19 10421787 missense probably damaging 1.00
R5979:Syt7 UTSW 19 10443479 missense probably damaging 1.00
R6737:Syt7 UTSW 19 10444044 missense probably damaging 1.00
R6833:Syt7 UTSW 19 10444144 missense probably damaging 1.00
R6843:Syt7 UTSW 19 10421771 missense probably damaging 1.00
R7010:Syt7 UTSW 19 10417990 missense probably benign 0.16
R7078:Syt7 UTSW 19 10435599 missense probably benign 0.14
R7206:Syt7 UTSW 19 10417973 missense probably damaging 1.00
Z1176:Syt7 UTSW 19 10443410 missense probably damaging 1.00
Z1177:Syt7 UTSW 19 10426493 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- ACCCTTGAGTCTATCCCCAG -3'
(R):5'- GGACCCTTAAACTTGCCAGAC -3'

Sequencing Primer
(F):5'- CTGAGCCAGAACCAGCAGG -3'
(R):5'- CACACTGTCAAGGACACAGAGG -3'
Posted On2016-09-06