Incidental Mutation 'R5373:Ptpn14'
ID428844
Institutional Source Beutler Lab
Gene Symbol Ptpn14
Ensembl Gene ENSMUSG00000026604
Gene Nameprotein tyrosine phosphatase, non-receptor type 14
SynonymsC130080N23Rik, PTP36, OTTMUSG00000022087
MMRRC Submission 042949-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5373 (G1)
Quality Score174
Status Validated
Chromosome1
Chromosomal Location189728268-189876695 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 189850963 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 669 (M669T)
Ref Sequence ENSEMBL: ENSMUSP00000095051 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027898] [ENSMUST00000097442]
Predicted Effect probably benign
Transcript: ENSMUST00000027898
SMART Domains Protein: ENSMUSP00000027898
Gene: ENSMUSG00000026604

DomainStartEndE-ValueType
B41 17 220 3.7e-67 SMART
FERM_C 224 310 3.43e-15 SMART
low complexity region 565 575 N/A INTRINSIC
low complexity region 633 639 N/A INTRINSIC
low complexity region 710 718 N/A INTRINSIC
low complexity region 745 758 N/A INTRINSIC
low complexity region 817 834 N/A INTRINSIC
PTPc 910 1184 2.14e-103 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000097442
AA Change: M669T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000095051
Gene: ENSMUSG00000026604
AA Change: M669T

DomainStartEndE-ValueType
B41 17 220 3.7e-67 SMART
FERM_C 224 310 3.43e-15 SMART
low complexity region 565 575 N/A INTRINSIC
low complexity region 633 639 N/A INTRINSIC
low complexity region 710 718 N/A INTRINSIC
low complexity region 745 758 N/A INTRINSIC
low complexity region 817 834 N/A INTRINSIC
PTPc 910 1184 2.14e-103 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128275
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195038
Meta Mutation Damage Score 0.0589 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 96% (74/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP contains an N-terminal noncatalytic domain similar to that of band 4.1 superfamily cytoskeleton-associated proteins, which suggested the membrane or cytoskeleton localization of this protein. It appears to regulate lymphatic development in mammals, and a loss of function mutation has been found in a kindred with a lymphedema-choanal atresia. [provided by RefSeq, Sep 2010]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit some postnatal growth retardation, decreased body weight, periorbital and limb edema, and lymphatic vessel hyperplasia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,067,635 S862G probably benign Het
2410089E03Rik T C 15: 8,270,803 V3198A unknown Het
Abcb5 G T 12: 118,887,177 T887K probably damaging Het
Adgrf1 G A 17: 43,291,005 probably benign Het
Adss T G 1: 177,796,388 I3L probably benign Het
Anapc7 T A 5: 122,438,217 D302E probably benign Het
Ank3 A G 10: 69,953,476 probably null Het
Arpp21 T G 9: 112,067,268 M687L probably benign Het
Camkv T C 9: 107,946,889 S221P probably benign Het
Ccdc88a C T 11: 29,463,409 T649M possibly damaging Het
Cdh12 A C 15: 21,583,912 S613R probably damaging Het
Chsy1 C T 7: 66,110,076 Q56* probably null Het
Cisd2 A G 3: 135,408,835 V125A probably benign Het
Cntnap2 T A 6: 47,107,969 H1121Q probably benign Het
Corin A T 5: 72,304,953 C876S probably damaging Het
Cspp1 T G 1: 10,134,126 L1038R probably damaging Het
Cwc15 A G 9: 14,504,938 K147E possibly damaging Het
Dlgap2 A G 8: 14,823,614 D739G probably benign Het
Dmxl2 A G 9: 54,369,189 probably benign Het
Dnajc6 T C 4: 101,615,627 I317T probably damaging Het
Dpysl3 T C 18: 43,361,036 Y193C probably damaging Het
Dtna T C 18: 23,651,613 Y730H probably damaging Het
Dusp3 A G 11: 101,984,625 Y38H possibly damaging Het
Eif3m A T 2: 105,012,932 I151N probably damaging Het
Eml2 A T 7: 19,179,263 D62V possibly damaging Het
Epb41l3 C A 17: 69,286,800 H810N probably damaging Het
Evc2 C T 5: 37,378,210 R410W probably damaging Het
Fam169b T C 7: 68,300,838 Y13H probably damaging Het
Fcrl5 A G 3: 87,446,391 T348A probably benign Het
Fezf2 A T 14: 12,344,803 V128E possibly damaging Het
Ighv3-5 A G 12: 114,262,953 S18P probably damaging Het
Kcnq5 T A 1: 21,961,571 H4L unknown Het
Kdm5d C T Y: 927,995 P756S probably benign Het
Lig1 AG A 7: 13,305,923 probably null Het
Ly75 A T 2: 60,311,771 L1332M possibly damaging Het
Med1 T A 11: 98,163,963 K378N probably damaging Het
Mn1 A G 5: 111,421,886 probably null Het
Mpo T C 11: 87,803,611 probably null Het
Mtfr2 G T 10: 20,352,852 C48F probably benign Het
Nt5c G A 11: 115,490,817 probably null Het
Pcdhga4 T C 18: 37,685,596 V66A probably damaging Het
Pik3c3 T C 18: 30,312,561 S534P probably benign Het
Pla2g4e A T 2: 120,186,395 C222S probably benign Het
Plch1 A C 3: 63,698,078 H1468Q probably benign Het
Psd2 T A 18: 36,007,503 W610R probably damaging Het
Ptgs1 A T 2: 36,251,186 K548N probably damaging Het
Ptprf G T 4: 118,226,041 T923K possibly damaging Het
Ptprg A G 14: 12,213,665 N1011S probably benign Het
Ptprz1 T A 6: 23,007,355 V1639E probably damaging Het
Rgsl1 C T 1: 153,790,307 V986I probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Rxfp2 A G 5: 150,070,260 T596A probably benign Het
Serpina3j A G 12: 104,314,727 D53G probably damaging Het
Slc26a7 A T 4: 14,546,447 I294N probably damaging Het
Slirp T C 12: 87,449,422 S96P possibly damaging Het
Snx6 T C 12: 54,770,728 E128G probably damaging Het
Spata6 T A 4: 111,822,834 probably null Het
Stap1 A G 5: 86,090,928 T152A possibly damaging Het
Susd5 G A 9: 114,082,585 G188R probably damaging Het
Thap2 A T 10: 115,372,839 Y125* probably null Het
Tnrc18 G A 5: 142,740,156 R1793C unknown Het
Ugt1a10 T A 1: 88,055,910 D143E probably damaging Het
Vmn1r85 A T 7: 13,084,328 Y296* probably null Het
Vmn2r71 C T 7: 85,618,542 T68I possibly damaging Het
Zc3h6 A T 2: 129,002,156 I207F possibly damaging Het
Zfp518a T C 19: 40,913,510 S628P probably benign Het
Zfp85 T C 13: 67,749,458 Y165C probably damaging Het
Zufsp T C 10: 33,927,466 N541D possibly damaging Het
Other mutations in Ptpn14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01014:Ptpn14 APN 1 189822633 missense probably damaging 1.00
IGL02501:Ptpn14 APN 1 189850390 missense probably benign 0.14
IGL03011:Ptpn14 APN 1 189839557 missense probably damaging 1.00
R0724:Ptpn14 UTSW 1 189850947 missense possibly damaging 0.52
R0791:Ptpn14 UTSW 1 189836440 splice site probably benign
R1363:Ptpn14 UTSW 1 189798628 missense probably damaging 1.00
R1605:Ptpn14 UTSW 1 189865512 missense probably benign 0.00
R1840:Ptpn14 UTSW 1 189786851 missense probably damaging 1.00
R1845:Ptpn14 UTSW 1 189839502 missense possibly damaging 0.96
R1891:Ptpn14 UTSW 1 189798653 missense probably damaging 1.00
R2187:Ptpn14 UTSW 1 189863228 nonsense probably null
R2288:Ptpn14 UTSW 1 189865498 missense probably damaging 1.00
R3686:Ptpn14 UTSW 1 189851399 missense probably damaging 1.00
R3895:Ptpn14 UTSW 1 189850546 missense probably benign 0.31
R3898:Ptpn14 UTSW 1 189850531 missense probably benign 0.35
R4004:Ptpn14 UTSW 1 189850510 missense probably benign 0.00
R4816:Ptpn14 UTSW 1 189856800 missense probably damaging 1.00
R4883:Ptpn14 UTSW 1 189850800 missense probably damaging 0.99
R4928:Ptpn14 UTSW 1 189822642 missense probably damaging 1.00
R4931:Ptpn14 UTSW 1 189851277 missense probably benign
R4957:Ptpn14 UTSW 1 189851272 missense probably benign 0.02
R5009:Ptpn14 UTSW 1 189850534 missense probably benign
R5038:Ptpn14 UTSW 1 189786886 missense probably damaging 1.00
R5264:Ptpn14 UTSW 1 189832800 critical splice donor site probably null
R5441:Ptpn14 UTSW 1 189798570 missense probably damaging 1.00
R5540:Ptpn14 UTSW 1 189846364 missense probably benign 0.05
R5638:Ptpn14 UTSW 1 189786841 missense probably damaging 1.00
R5746:Ptpn14 UTSW 1 189846413 critical splice donor site probably null
R5872:Ptpn14 UTSW 1 189851032 missense probably benign 0.00
R5988:Ptpn14 UTSW 1 189850387 missense probably damaging 1.00
R6139:Ptpn14 UTSW 1 189851165 missense probably benign 0.01
R6295:Ptpn14 UTSW 1 189850800 missense probably damaging 0.99
R6770:Ptpn14 UTSW 1 189832773 missense probably damaging 1.00
R7097:Ptpn14 UTSW 1 189863398 nonsense probably null
R7320:Ptpn14 UTSW 1 189832759 missense probably benign 0.11
R7324:Ptpn14 UTSW 1 189863424 missense possibly damaging 0.46
R7599:Ptpn14 UTSW 1 189850745 missense probably benign 0.39
R7699:Ptpn14 UTSW 1 189865411 missense probably benign 0.08
R7700:Ptpn14 UTSW 1 189865411 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- AGGTGCAGCTCTCCGTAAAG -3'
(R):5'- TTCTACTTTCTCTCGAAGCACAGG -3'

Sequencing Primer
(F):5'- TCCGTAAAGACCTTCCAGGAGG -3'
(R):5'- TCTCGAAGCACAGGAACCTGAG -3'
Posted On2016-09-06