Incidental Mutation 'R5373:Mn1'
ID428860
Institutional Source Beutler Lab
Gene Symbol Mn1
Ensembl Gene ENSMUSG00000070576
Gene Namemeningioma 1
Synonyms
MMRRC Submission 042949-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5373 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location111417362-111457033 bp(+) (GRCm38)
Type of Mutationsplice site (3 bp from exon)
DNA Base Change (assembly) A to G at 111421886 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000092034 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094463]
Predicted Effect probably null
Transcript: ENSMUST00000094463
SMART Domains Protein: ENSMUSP00000092034
Gene: ENSMUSG00000070576

DomainStartEndE-ValueType
low complexity region 92 124 N/A INTRINSIC
low complexity region 128 144 N/A INTRINSIC
low complexity region 201 217 N/A INTRINSIC
low complexity region 291 303 N/A INTRINSIC
low complexity region 333 354 N/A INTRINSIC
coiled coil region 507 548 N/A INTRINSIC
low complexity region 551 565 N/A INTRINSIC
low complexity region 569 584 N/A INTRINSIC
low complexity region 643 657 N/A INTRINSIC
low complexity region 685 704 N/A INTRINSIC
low complexity region 708 725 N/A INTRINSIC
low complexity region 727 738 N/A INTRINSIC
low complexity region 745 771 N/A INTRINSIC
low complexity region 780 791 N/A INTRINSIC
low complexity region 862 892 N/A INTRINSIC
low complexity region 913 933 N/A INTRINSIC
low complexity region 957 972 N/A INTRINSIC
low complexity region 1098 1110 N/A INTRINSIC
low complexity region 1134 1145 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138784
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196957
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 96% (74/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Meningioma 1 (MN1) contains two sets of CAG repeats. It is disrupted by a balanced translocation (4;22) in a meningioma, and its inactivation may contribute to meningioma 32 pathogenesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice die shortly after birth due to cleft palate. Development of several bones in the skull was abnormal with completely absent alisphenoid, squamosal, and vomer bones, hypoplastic basisphenoid, pterygoid, and presphenoid bones, and thinfrontal, parietal, and interparietal bones. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,067,635 S862G probably benign Het
2410089E03Rik T C 15: 8,270,803 V3198A unknown Het
Abcb5 G T 12: 118,887,177 T887K probably damaging Het
Adgrf1 G A 17: 43,291,005 probably benign Het
Adss T G 1: 177,796,388 I3L probably benign Het
Anapc7 T A 5: 122,438,217 D302E probably benign Het
Ank3 A G 10: 69,953,476 probably null Het
Arpp21 T G 9: 112,067,268 M687L probably benign Het
Camkv T C 9: 107,946,889 S221P probably benign Het
Ccdc88a C T 11: 29,463,409 T649M possibly damaging Het
Cdh12 A C 15: 21,583,912 S613R probably damaging Het
Chsy1 C T 7: 66,110,076 Q56* probably null Het
Cisd2 A G 3: 135,408,835 V125A probably benign Het
Cntnap2 T A 6: 47,107,969 H1121Q probably benign Het
Corin A T 5: 72,304,953 C876S probably damaging Het
Cspp1 T G 1: 10,134,126 L1038R probably damaging Het
Cwc15 A G 9: 14,504,938 K147E possibly damaging Het
Dlgap2 A G 8: 14,823,614 D739G probably benign Het
Dmxl2 A G 9: 54,369,189 probably benign Het
Dnajc6 T C 4: 101,615,627 I317T probably damaging Het
Dpysl3 T C 18: 43,361,036 Y193C probably damaging Het
Dtna T C 18: 23,651,613 Y730H probably damaging Het
Dusp3 A G 11: 101,984,625 Y38H possibly damaging Het
Eif3m A T 2: 105,012,932 I151N probably damaging Het
Eml2 A T 7: 19,179,263 D62V possibly damaging Het
Epb41l3 C A 17: 69,286,800 H810N probably damaging Het
Evc2 C T 5: 37,378,210 R410W probably damaging Het
Fam169b T C 7: 68,300,838 Y13H probably damaging Het
Fcrl5 A G 3: 87,446,391 T348A probably benign Het
Fezf2 A T 14: 12,344,803 V128E possibly damaging Het
Ighv3-5 A G 12: 114,262,953 S18P probably damaging Het
Kcnq5 T A 1: 21,961,571 H4L unknown Het
Kdm5d C T Y: 927,995 P756S probably benign Het
Lig1 AG A 7: 13,305,923 probably null Het
Ly75 A T 2: 60,311,771 L1332M possibly damaging Het
Med1 T A 11: 98,163,963 K378N probably damaging Het
Mpo T C 11: 87,803,611 probably null Het
Mtfr2 G T 10: 20,352,852 C48F probably benign Het
Nt5c G A 11: 115,490,817 probably null Het
Pcdhga4 T C 18: 37,685,596 V66A probably damaging Het
Pik3c3 T C 18: 30,312,561 S534P probably benign Het
Pla2g4e A T 2: 120,186,395 C222S probably benign Het
Plch1 A C 3: 63,698,078 H1468Q probably benign Het
Psd2 T A 18: 36,007,503 W610R probably damaging Het
Ptgs1 A T 2: 36,251,186 K548N probably damaging Het
Ptpn14 T C 1: 189,850,963 M669T probably benign Het
Ptprf G T 4: 118,226,041 T923K possibly damaging Het
Ptprg A G 14: 12,213,665 N1011S probably benign Het
Ptprz1 T A 6: 23,007,355 V1639E probably damaging Het
Rgsl1 C T 1: 153,790,307 V986I probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Rxfp2 A G 5: 150,070,260 T596A probably benign Het
Serpina3j A G 12: 104,314,727 D53G probably damaging Het
Slc26a7 A T 4: 14,546,447 I294N probably damaging Het
Slirp T C 12: 87,449,422 S96P possibly damaging Het
Snx6 T C 12: 54,770,728 E128G probably damaging Het
Spata6 T A 4: 111,822,834 probably null Het
Stap1 A G 5: 86,090,928 T152A possibly damaging Het
Susd5 G A 9: 114,082,585 G188R probably damaging Het
Thap2 A T 10: 115,372,839 Y125* probably null Het
Tnrc18 G A 5: 142,740,156 R1793C unknown Het
Ugt1a10 T A 1: 88,055,910 D143E probably damaging Het
Vmn1r85 A T 7: 13,084,328 Y296* probably null Het
Vmn2r71 C T 7: 85,618,542 T68I possibly damaging Het
Zc3h6 A T 2: 129,002,156 I207F possibly damaging Het
Zfp518a T C 19: 40,913,510 S628P probably benign Het
Zfp85 T C 13: 67,749,458 Y165C probably damaging Het
Zufsp T C 10: 33,927,466 N541D possibly damaging Het
Other mutations in Mn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01019:Mn1 APN 5 111421547 missense possibly damaging 0.85
IGL01139:Mn1 APN 5 111421449 missense probably damaging 0.96
IGL01546:Mn1 APN 5 111421248 missense probably damaging 1.00
IGL02252:Mn1 APN 5 111421241 missense probably damaging 0.96
IGL02821:Mn1 APN 5 111421851 missense probably damaging 0.99
IGL03203:Mn1 APN 5 111421403 missense probably benign
Uebermus UTSW 5 111421886 splice site probably null
FR4342:Mn1 UTSW 5 111419706 small insertion probably benign
FR4449:Mn1 UTSW 5 111419710 small insertion probably benign
FR4548:Mn1 UTSW 5 111419698 small insertion probably benign
FR4976:Mn1 UTSW 5 111419702 small insertion probably benign
R0639:Mn1 UTSW 5 111419316 missense probably damaging 1.00
R0676:Mn1 UTSW 5 111421034 missense possibly damaging 0.52
R1537:Mn1 UTSW 5 111454780 missense probably damaging 0.96
R1638:Mn1 UTSW 5 111421569 missense probably damaging 1.00
R1739:Mn1 UTSW 5 111420014 missense possibly damaging 0.92
R1922:Mn1 UTSW 5 111418746 missense probably damaging 0.99
R2008:Mn1 UTSW 5 111418857 missense probably damaging 1.00
R2104:Mn1 UTSW 5 111454751 missense possibly damaging 0.72
R2519:Mn1 UTSW 5 111418552 missense possibly damaging 0.85
R3980:Mn1 UTSW 5 111421770 missense possibly damaging 0.85
R4008:Mn1 UTSW 5 111420169 missense probably benign
R4564:Mn1 UTSW 5 111420667 missense possibly damaging 0.93
R4647:Mn1 UTSW 5 111420083 missense probably benign
R4779:Mn1 UTSW 5 111419660 missense probably damaging 0.99
R4819:Mn1 UTSW 5 111419937 missense possibly damaging 0.93
R4962:Mn1 UTSW 5 111454786 missense possibly damaging 0.85
R5374:Mn1 UTSW 5 111421886 splice site probably null
R5521:Mn1 UTSW 5 111421769 missense possibly damaging 0.72
R5633:Mn1 UTSW 5 111420326 missense possibly damaging 0.52
R5744:Mn1 UTSW 5 111420536 missense possibly damaging 0.93
R6050:Mn1 UTSW 5 111419397 missense probably damaging 1.00
R6552:Mn1 UTSW 5 111420887 missense possibly damaging 0.93
R7206:Mn1 UTSW 5 111420512 missense possibly damaging 0.85
R7244:Mn1 UTSW 5 111418833 missense possibly damaging 0.78
RF025:Mn1 UTSW 5 111419705 nonsense probably null
RF027:Mn1 UTSW 5 111419705 small insertion probably benign
RF028:Mn1 UTSW 5 111419711 small insertion probably benign
RF032:Mn1 UTSW 5 111419711 small insertion probably benign
RF040:Mn1 UTSW 5 111419705 small insertion probably benign
Z1088:Mn1 UTSW 5 111418280 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- AAGCAGTCAAGAGCGCCATG -3'
(R):5'- AGGGGTCCCAAACACTTAAG -3'

Sequencing Primer
(F):5'- ATGAGTACTATCGACCTGGACTC -3'
(R):5'- AATAGGAGGGGCCCAGCTTC -3'
Posted On2016-09-06