Incidental Mutation 'R5373:Chsy1'
ID428869
Institutional Source Beutler Lab
Gene Symbol Chsy1
Ensembl Gene ENSMUSG00000032640
Gene Namechondroitin sulfate synthase 1
Synonyms
MMRRC Submission 042949-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5373 (G1)
Quality Score114
Status Validated
Chromosome7
Chromosomal Location66109515-66173798 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 66110076 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 56 (Q56*)
Ref Sequence ENSEMBL: ENSMUSP00000047487 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036372]
Predicted Effect probably null
Transcript: ENSMUST00000036372
AA Change: Q56*
SMART Domains Protein: ENSMUSP00000047487
Gene: ENSMUSG00000032640
AA Change: Q56*

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Fringe 81 307 3.8e-21 PFAM
Pfam:CHGN 237 776 9.8e-197 PFAM
Pfam:Glyco_tranf_2_2 548 751 1.2e-10 PFAM
Pfam:Glyco_transf_7C 674 747 2.5e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181911
Meta Mutation Damage Score 0.9703 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 96% (74/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the chondroitin N-acetylgalactosaminyltransferase family. These enzymes possess dual glucuronyltransferase and galactosaminyltransferase activity and play critical roles in the biosynthesis of chondroitin sulfate, a glycosaminoglycan involved in many biological processes including cell proliferation and morphogenesis. Decreased expression of this gene may play a role in colorectal cancer, and mutations in this gene are a cause of temtamy preaxial brachydactyly syndrome. [provided by RefSeq, Dec 2011]
PHENOTYPE: Homozygous mice are viable, but display chondrodysplasia, brachydactyly and decreased bone density. Retinal degeneration, impaired motor strength, and hematological abnormalities are also seen. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,067,635 S862G probably benign Het
2410089E03Rik T C 15: 8,270,803 V3198A unknown Het
Abcb5 G T 12: 118,887,177 T887K probably damaging Het
Adgrf1 G A 17: 43,291,005 probably benign Het
Adss T G 1: 177,796,388 I3L probably benign Het
Anapc7 T A 5: 122,438,217 D302E probably benign Het
Ank3 A G 10: 69,953,476 probably null Het
Arpp21 T G 9: 112,067,268 M687L probably benign Het
Camkv T C 9: 107,946,889 S221P probably benign Het
Ccdc88a C T 11: 29,463,409 T649M possibly damaging Het
Cdh12 A C 15: 21,583,912 S613R probably damaging Het
Cisd2 A G 3: 135,408,835 V125A probably benign Het
Cntnap2 T A 6: 47,107,969 H1121Q probably benign Het
Corin A T 5: 72,304,953 C876S probably damaging Het
Cspp1 T G 1: 10,134,126 L1038R probably damaging Het
Cwc15 A G 9: 14,504,938 K147E possibly damaging Het
Dlgap2 A G 8: 14,823,614 D739G probably benign Het
Dmxl2 A G 9: 54,369,189 probably benign Het
Dnajc6 T C 4: 101,615,627 I317T probably damaging Het
Dpysl3 T C 18: 43,361,036 Y193C probably damaging Het
Dtna T C 18: 23,651,613 Y730H probably damaging Het
Dusp3 A G 11: 101,984,625 Y38H possibly damaging Het
Eif3m A T 2: 105,012,932 I151N probably damaging Het
Eml2 A T 7: 19,179,263 D62V possibly damaging Het
Epb41l3 C A 17: 69,286,800 H810N probably damaging Het
Evc2 C T 5: 37,378,210 R410W probably damaging Het
Fam169b T C 7: 68,300,838 Y13H probably damaging Het
Fcrl5 A G 3: 87,446,391 T348A probably benign Het
Fezf2 A T 14: 12,344,803 V128E possibly damaging Het
Ighv3-5 A G 12: 114,262,953 S18P probably damaging Het
Kcnq5 T A 1: 21,961,571 H4L unknown Het
Kdm5d C T Y: 927,995 P756S probably benign Het
Lig1 AG A 7: 13,305,923 probably null Het
Ly75 A T 2: 60,311,771 L1332M possibly damaging Het
Med1 T A 11: 98,163,963 K378N probably damaging Het
Mn1 A G 5: 111,421,886 probably null Het
Mpo T C 11: 87,803,611 probably null Het
Mtfr2 G T 10: 20,352,852 C48F probably benign Het
Nt5c G A 11: 115,490,817 probably null Het
Pcdhga4 T C 18: 37,685,596 V66A probably damaging Het
Pik3c3 T C 18: 30,312,561 S534P probably benign Het
Pla2g4e A T 2: 120,186,395 C222S probably benign Het
Plch1 A C 3: 63,698,078 H1468Q probably benign Het
Psd2 T A 18: 36,007,503 W610R probably damaging Het
Ptgs1 A T 2: 36,251,186 K548N probably damaging Het
Ptpn14 T C 1: 189,850,963 M669T probably benign Het
Ptprf G T 4: 118,226,041 T923K possibly damaging Het
Ptprg A G 14: 12,213,665 N1011S probably benign Het
Ptprz1 T A 6: 23,007,355 V1639E probably damaging Het
Rgsl1 C T 1: 153,790,307 V986I probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Rxfp2 A G 5: 150,070,260 T596A probably benign Het
Serpina3j A G 12: 104,314,727 D53G probably damaging Het
Slc26a7 A T 4: 14,546,447 I294N probably damaging Het
Slirp T C 12: 87,449,422 S96P possibly damaging Het
Snx6 T C 12: 54,770,728 E128G probably damaging Het
Spata6 T A 4: 111,822,834 probably null Het
Stap1 A G 5: 86,090,928 T152A possibly damaging Het
Susd5 G A 9: 114,082,585 G188R probably damaging Het
Thap2 A T 10: 115,372,839 Y125* probably null Het
Tnrc18 G A 5: 142,740,156 R1793C unknown Het
Ugt1a10 T A 1: 88,055,910 D143E probably damaging Het
Vmn1r85 A T 7: 13,084,328 Y296* probably null Het
Vmn2r71 C T 7: 85,618,542 T68I possibly damaging Het
Zc3h6 A T 2: 129,002,156 I207F possibly damaging Het
Zfp518a T C 19: 40,913,510 S628P probably benign Het
Zfp85 T C 13: 67,749,458 Y165C probably damaging Het
Zufsp T C 10: 33,927,466 N541D possibly damaging Het
Other mutations in Chsy1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01087:Chsy1 APN 7 66172126 missense possibly damaging 0.70
IGL01734:Chsy1 APN 7 66171310 missense probably damaging 0.98
IGL02037:Chsy1 APN 7 66171828 missense possibly damaging 0.69
IGL02797:Chsy1 APN 7 66171664 missense probably damaging 1.00
IGL02961:Chsy1 APN 7 66171782 missense probably benign 0.00
IGL03290:Chsy1 APN 7 66171031 missense probably benign 0.15
IGL03292:Chsy1 APN 7 66125372 missense probably benign 0.02
deprimido UTSW 7 66171687 missense probably damaging 1.00
Elevado UTSW 7 66110076 nonsense probably null
R0669:Chsy1 UTSW 7 66171687 missense probably damaging 1.00
R1336:Chsy1 UTSW 7 66125239 splice site probably null
R1499:Chsy1 UTSW 7 66172002 missense probably damaging 1.00
R1640:Chsy1 UTSW 7 66171514 missense probably benign 0.34
R1674:Chsy1 UTSW 7 66171663 missense probably damaging 1.00
R1812:Chsy1 UTSW 7 66171817 missense probably benign 0.12
R1934:Chsy1 UTSW 7 66172243 missense probably damaging 1.00
R2964:Chsy1 UTSW 7 66172164 missense probably damaging 1.00
R2965:Chsy1 UTSW 7 66172164 missense probably damaging 1.00
R2966:Chsy1 UTSW 7 66172164 missense probably damaging 1.00
R3692:Chsy1 UTSW 7 66171253 missense probably damaging 1.00
R4890:Chsy1 UTSW 7 66110226 missense probably benign 0.00
R5936:Chsy1 UTSW 7 66172277 missense possibly damaging 0.89
R6149:Chsy1 UTSW 7 66125385 missense probably damaging 1.00
R6192:Chsy1 UTSW 7 66170877 missense probably benign 0.29
R6653:Chsy1 UTSW 7 66110193 missense probably benign 0.10
R6848:Chsy1 UTSW 7 66171037 missense probably damaging 1.00
R7318:Chsy1 UTSW 7 66110229 critical splice donor site probably null
R7514:Chsy1 UTSW 7 66172120 missense probably damaging 1.00
R7560:Chsy1 UTSW 7 66171244 missense possibly damaging 0.85
R7560:Chsy1 UTSW 7 66171571 missense probably damaging 1.00
R7655:Chsy1 UTSW 7 66171030 missense probably damaging 0.98
R7656:Chsy1 UTSW 7 66171030 missense probably damaging 0.98
X0012:Chsy1 UTSW 7 66172168 missense probably damaging 1.00
X0063:Chsy1 UTSW 7 66171924 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- CATGGTCCCCTCTTAAAGGC -3'
(R):5'- TTGCCCTTGAGAGATGCTC -3'

Sequencing Primer
(F):5'- TCCCCTCTTAAAGGCGCAGG -3'
(R):5'- ATGCAGGCGATGGCATC -3'
Posted On2016-09-06