Incidental Mutation 'R5373:Psd2'
ID428900
Institutional Source Beutler Lab
Gene Symbol Psd2
Ensembl Gene ENSMUSG00000024347
Gene Namepleckstrin and Sec7 domain containing 2
SynonymsEFA6C, 6330404E20Rik
MMRRC Submission 042949-MU
Accession Numbers

Genbank: NM_028707

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5373 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location35964830-36014715 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 36007503 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 610 (W610R)
Ref Sequence ENSEMBL: ENSMUSP00000135431 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115716] [ENSMUST00000175734] [ENSMUST00000176472] [ENSMUST00000176873] [ENSMUST00000177432]
Predicted Effect probably damaging
Transcript: ENSMUST00000115716
AA Change: W613R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000111381
Gene: ENSMUSG00000024347
AA Change: W613R

DomainStartEndE-ValueType
low complexity region 153 169 N/A INTRINSIC
low complexity region 216 234 N/A INTRINSIC
low complexity region 247 264 N/A INTRINSIC
Sec7 270 461 4.69e-56 SMART
PH 510 624 4.35e-14 SMART
Blast:Sec7 653 705 4e-24 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175720
Predicted Effect probably damaging
Transcript: ENSMUST00000175734
AA Change: W614R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135795
Gene: ENSMUSG00000024347
AA Change: W614R

DomainStartEndE-ValueType
low complexity region 153 169 N/A INTRINSIC
low complexity region 216 234 N/A INTRINSIC
low complexity region 247 264 N/A INTRINSIC
Sec7 270 462 4.1e-55 SMART
PH 511 625 1.9e-16 SMART
Blast:Sec7 654 706 4e-24 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000176472
SMART Domains Protein: ENSMUSP00000135285
Gene: ENSMUSG00000024347

DomainStartEndE-ValueType
low complexity region 153 169 N/A INTRINSIC
low complexity region 216 234 N/A INTRINSIC
low complexity region 247 264 N/A INTRINSIC
Sec7 270 461 4.69e-56 SMART
Pfam:PH_9 511 553 4.5e-12 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000176873
AA Change: W614R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135616
Gene: ENSMUSG00000024347
AA Change: W614R

DomainStartEndE-ValueType
low complexity region 153 169 N/A INTRINSIC
low complexity region 216 234 N/A INTRINSIC
low complexity region 247 264 N/A INTRINSIC
Sec7 270 462 4.2e-55 SMART
PH 511 625 1.9e-16 SMART
Blast:Sec7 654 706 4e-24 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000177432
AA Change: W610R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135431
Gene: ENSMUSG00000024347
AA Change: W610R

DomainStartEndE-ValueType
low complexity region 153 169 N/A INTRINSIC
low complexity region 216 234 N/A INTRINSIC
low complexity region 247 264 N/A INTRINSIC
Sec7 270 461 4.69e-56 SMART
PH 510 621 5.36e-14 SMART
Blast:Sec7 650 702 4e-24 BLAST
Meta Mutation Damage Score 0.9518 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 96% (74/77)
Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,067,635 S862G probably benign Het
2410089E03Rik T C 15: 8,270,803 V3198A unknown Het
Abcb5 G T 12: 118,887,177 T887K probably damaging Het
Adgrf1 G A 17: 43,291,005 probably benign Het
Adss T G 1: 177,796,388 I3L probably benign Het
Anapc7 T A 5: 122,438,217 D302E probably benign Het
Ank3 A G 10: 69,953,476 probably null Het
Arpp21 T G 9: 112,067,268 M687L probably benign Het
Camkv T C 9: 107,946,889 S221P probably benign Het
Ccdc88a C T 11: 29,463,409 T649M possibly damaging Het
Cdh12 A C 15: 21,583,912 S613R probably damaging Het
Chsy1 C T 7: 66,110,076 Q56* probably null Het
Cisd2 A G 3: 135,408,835 V125A probably benign Het
Cntnap2 T A 6: 47,107,969 H1121Q probably benign Het
Corin A T 5: 72,304,953 C876S probably damaging Het
Cspp1 T G 1: 10,134,126 L1038R probably damaging Het
Cwc15 A G 9: 14,504,938 K147E possibly damaging Het
Dlgap2 A G 8: 14,823,614 D739G probably benign Het
Dmxl2 A G 9: 54,369,189 probably benign Het
Dnajc6 T C 4: 101,615,627 I317T probably damaging Het
Dpysl3 T C 18: 43,361,036 Y193C probably damaging Het
Dtna T C 18: 23,651,613 Y730H probably damaging Het
Dusp3 A G 11: 101,984,625 Y38H possibly damaging Het
Eif3m A T 2: 105,012,932 I151N probably damaging Het
Eml2 A T 7: 19,179,263 D62V possibly damaging Het
Epb41l3 C A 17: 69,286,800 H810N probably damaging Het
Evc2 C T 5: 37,378,210 R410W probably damaging Het
Fam169b T C 7: 68,300,838 Y13H probably damaging Het
Fcrl5 A G 3: 87,446,391 T348A probably benign Het
Fezf2 A T 14: 12,344,803 V128E possibly damaging Het
Ighv3-5 A G 12: 114,262,953 S18P probably damaging Het
Kcnq5 T A 1: 21,961,571 H4L unknown Het
Kdm5d C T Y: 927,995 P756S probably benign Het
Lig1 AG A 7: 13,305,923 probably null Het
Ly75 A T 2: 60,311,771 L1332M possibly damaging Het
Med1 T A 11: 98,163,963 K378N probably damaging Het
Mn1 A G 5: 111,421,886 probably null Het
Mpo T C 11: 87,803,611 probably null Het
Mtfr2 G T 10: 20,352,852 C48F probably benign Het
Nt5c G A 11: 115,490,817 probably null Het
Pcdhga4 T C 18: 37,685,596 V66A probably damaging Het
Pik3c3 T C 18: 30,312,561 S534P probably benign Het
Pla2g4e A T 2: 120,186,395 C222S probably benign Het
Plch1 A C 3: 63,698,078 H1468Q probably benign Het
Ptgs1 A T 2: 36,251,186 K548N probably damaging Het
Ptpn14 T C 1: 189,850,963 M669T probably benign Het
Ptprf G T 4: 118,226,041 T923K possibly damaging Het
Ptprg A G 14: 12,213,665 N1011S probably benign Het
Ptprz1 T A 6: 23,007,355 V1639E probably damaging Het
Rgsl1 C T 1: 153,790,307 V986I probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Rxfp2 A G 5: 150,070,260 T596A probably benign Het
Serpina3j A G 12: 104,314,727 D53G probably damaging Het
Slc26a7 A T 4: 14,546,447 I294N probably damaging Het
Slirp T C 12: 87,449,422 S96P possibly damaging Het
Snx6 T C 12: 54,770,728 E128G probably damaging Het
Spata6 T A 4: 111,822,834 probably null Het
Stap1 A G 5: 86,090,928 T152A possibly damaging Het
Susd5 G A 9: 114,082,585 G188R probably damaging Het
Thap2 A T 10: 115,372,839 Y125* probably null Het
Tnrc18 G A 5: 142,740,156 R1793C unknown Het
Ugt1a10 T A 1: 88,055,910 D143E probably damaging Het
Vmn1r85 A T 7: 13,084,328 Y296* probably null Het
Vmn2r71 C T 7: 85,618,542 T68I possibly damaging Het
Zc3h6 A T 2: 129,002,156 I207F possibly damaging Het
Zfp518a T C 19: 40,913,510 S628P probably benign Het
Zfp85 T C 13: 67,749,458 Y165C probably damaging Het
Zufsp T C 10: 33,927,466 N541D possibly damaging Het
Other mutations in Psd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01486:Psd2 APN 18 35980335 missense probably benign 0.00
IGL01578:Psd2 APN 18 35979785 missense probably damaging 1.00
IGL02086:Psd2 APN 18 36005906 missense probably damaging 1.00
IGL02132:Psd2 APN 18 36004756 splice site probably benign
IGL02480:Psd2 APN 18 36006083 missense probably damaging 1.00
IGL02726:Psd2 APN 18 35987302 critical splice donor site probably null
Arachnida UTSW 18 36006723 splice site probably null
recluse UTSW 18 35979711 missense probably damaging 1.00
widow UTSW 18 35980425 missense probably damaging 0.99
3-1:Psd2 UTSW 18 35984401 missense probably damaging 1.00
R0103:Psd2 UTSW 18 36004717 missense probably damaging 1.00
R0103:Psd2 UTSW 18 36004717 missense probably damaging 1.00
R0320:Psd2 UTSW 18 35979644 missense probably damaging 1.00
R0573:Psd2 UTSW 18 35980493 splice site probably benign
R0685:Psd2 UTSW 18 36002991 missense possibly damaging 0.90
R0698:Psd2 UTSW 18 36012711 missense probably benign 0.22
R0730:Psd2 UTSW 18 35978574 missense possibly damaging 0.85
R0971:Psd2 UTSW 18 35979786 missense probably damaging 1.00
R1085:Psd2 UTSW 18 36012777 missense probably benign 0.10
R1535:Psd2 UTSW 18 36005790 missense probably benign 0.31
R2056:Psd2 UTSW 18 36006691 missense possibly damaging 0.60
R4011:Psd2 UTSW 18 35987247 missense probably benign 0.01
R4246:Psd2 UTSW 18 36006119 missense probably damaging 1.00
R4335:Psd2 UTSW 18 36007530 missense probably damaging 0.96
R4584:Psd2 UTSW 18 36012828 missense probably benign
R4942:Psd2 UTSW 18 35978664 missense probably damaging 1.00
R5120:Psd2 UTSW 18 35979810 missense possibly damaging 0.92
R5374:Psd2 UTSW 18 36007503 missense probably damaging 1.00
R5839:Psd2 UTSW 18 36007524 missense probably damaging 0.97
R6200:Psd2 UTSW 18 36006723 splice site probably null
R6925:Psd2 UTSW 18 35979711 missense probably damaging 1.00
R6967:Psd2 UTSW 18 35980332 missense probably damaging 0.97
R7074:Psd2 UTSW 18 36010684 missense probably benign 0.03
R7142:Psd2 UTSW 18 35980044 missense possibly damaging 0.85
R7239:Psd2 UTSW 18 35980419 missense probably damaging 1.00
R7348:Psd2 UTSW 18 35980336 missense possibly damaging 0.85
R7581:Psd2 UTSW 18 35979997 missense probably benign 0.01
R7793:Psd2 UTSW 18 36002979 missense probably benign 0.37
R8221:Psd2 UTSW 18 35980425 missense probably damaging 0.99
R8310:Psd2 UTSW 18 35979713 missense probably damaging 1.00
X0065:Psd2 UTSW 18 36002942 missense possibly damaging 0.92
Z1177:Psd2 UTSW 18 35978280 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- CTATGTAGTTCTGACCAGGCTC -3'
(R):5'- AGAATAGCTCTCCTTCCCGG -3'

Sequencing Primer
(F):5'- ATGTAGTTCTGACCAGGCTCATTCAC -3'
(R):5'- GCCCAGTACTACATGATCCAGAG -3'
Posted On2016-09-06