Mutagenetix > Incidental Mutations

Incidental Mutation 'R5374:Rgsl1'

428908

Institutional Source

Beutler Lab

Gene Symbol

Rgsl1

Ensembl Gene

ENSMUSG00000042641

Gene Name

regulator of G-protein signaling like 1

Synonyms

Rgsl2, 4930415K13Rik

MMRRC Submission

042950-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5374 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

153779381-153844142 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 153790307 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Isoleucine at position 986 (V986I)

Ref Sequence

ENSEMBL: ENSMUSP00000135642 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000124558] [ENSMUST00000141249] [ENSMUST00000185164]

Predicted Effect

probably benign
Transcript: ENSMUST00000124558
AA Change: V986I

PolyPhen 2 Score 0.326 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000135642
Gene: ENSMUSG00000042641
AA Change: V986I

Domain	Start	End	E-Value	Type
low complexity region	122	136	N/A	INTRINSIC
low complexity region	242	254	N/A	INTRINSIC
low complexity region	316	325	N/A	INTRINSIC
Pfam:RGS	644	754	7.1e-12	PFAM
transmembrane domain	956	973	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134030

Predicted Effect

probably benign
Transcript: ENSMUST00000141249
AA Change: V306I

PolyPhen 2 Score 0.223 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000139215
Gene: ENSMUSG00000042641
AA Change: V306I

Domain	Start	End	E-Value	Type
Blast:RGS	3	300	3e-30	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145308

Predicted Effect

probably benign
Transcript: ENSMUST00000184095

Predicted Effect

probably benign
Transcript: ENSMUST00000185164

SMART Domains

Protein: ENSMUSP00000139340
Gene: ENSMUSG00000042641

Domain	Start	End	E-Value	Type
low complexity region	157	171	N/A	INTRINSIC
low complexity region	277	289	N/A	INTRINSIC
low complexity region	351	360	N/A	INTRINSIC
Pfam:RGS	679	789	4.1e-11	PFAM

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.2%
20x: 95.2%

Validation Efficiency

96% (81/84)

Allele List at MGI

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110002E22Rik	A	G	3: 138,067,635	S862G	probably benign	Het
2410089E03Rik	T	C	15: 8,270,803	V3198A	unknown	Het
Adgrf1	G	A	17: 43,291,005		probably benign	Het
Adss	T	G	1: 177,796,388	I3L	probably benign	Het
Anapc7	T	A	5: 122,438,217	D302E	probably benign	Het
Ank3	A	G	10: 69,953,476		probably null	Het
Astn2	A	C	4: 65,397,005	V1145G	probably damaging	Het
Babam2	C	T	5: 32,007,230		probably benign	Het
Blvrb	A	G	7: 27,465,846	H238R	possibly damaging	Het
Cacna1b	C	T	2: 24,706,216	V488I	probably damaging	Het
Ccdc88a	C	T	11: 29,463,409	T649M	possibly damaging	Het
Cdh12	A	C	15: 21,583,912	S613R	probably damaging	Het
Cisd2	A	G	3: 135,408,835	V125A	probably benign	Het
Clcn2	C	A	16: 20,709,669	G478W	possibly damaging	Het
Cntnap2	T	A	6: 47,107,969	H1121Q	probably benign	Het
Corin	A	T	5: 72,304,953	C876S	probably damaging	Het
Cox7c	T	C	13: 86,046,620	Y19C	probably benign	Het
Cspp1	T	G	1: 10,134,126	L1038R	probably damaging	Het
Cwc15	A	G	9: 14,504,938	K147E	possibly damaging	Het
Dlgap2	A	G	8: 14,823,614	D739G	probably benign	Het
Dmxl2	A	G	9: 54,369,189		probably benign	Het
Dock5	A	G	14: 67,805,756	V864A	possibly damaging	Het
Dock7	A	G	4: 98,989,038	F1088L	possibly damaging	Het
Dpysl3	T	C	18: 43,361,036	Y193C	probably damaging	Het
Dtna	T	C	18: 23,651,613	Y730H	probably damaging	Het
Dusp3	A	G	11: 101,984,625	Y38H	possibly damaging	Het
Eif3m	A	T	2: 105,012,932	I151N	probably damaging	Het
Entpd2	C	T	2: 25,399,726	T380I	probably damaging	Het
Epb41l3	C	A	17: 69,286,800	H810N	probably damaging	Het
Fcrl5	A	G	3: 87,446,391	T348A	probably benign	Het
Ginm1	A	G	10: 7,779,314	S55P	probably damaging	Het
Glt1d1	C	A	5: 127,657,084		probably null	Het
Gm15433	T	A	1: 84,964,112		noncoding transcript	Het
Gm8221	A	G	15: 77,626,152		noncoding transcript	Het
Gramd1c	A	G	16: 43,983,241	V603A	probably benign	Het
Grm1	A	G	10: 11,080,442	S33P	probably benign	Het
Gstp3	T	C	19: 4,057,922	N137S	possibly damaging	Het
Kdm5d	C	T	Y: 927,995	P756S	probably benign	Het
Ly75	A	T	2: 60,311,771	L1332M	possibly damaging	Het
Med1	T	A	11: 98,163,963	K378N	probably damaging	Het
Mn1	A	G	5: 111,421,886		probably null	Het
Mpo	T	C	11: 87,803,611		probably null	Het
Nom1	C	G	5: 29,441,379	R555G	probably damaging	Het
Nsmce4a	C	T	7: 130,538,170	R276Q	probably benign	Het
Nt5c	G	A	11: 115,490,817		probably null	Het
Olfr472	T	C	7: 107,903,491	I258T	possibly damaging	Het
Olfr670	G	T	7: 104,959,996	H245Q	probably damaging	Het
Olfr908	CACAACAACA	CACAACA	9: 38,516,138		probably benign	Het
Pcdhga4	T	C	18: 37,685,596	V66A	probably damaging	Het
Pik3c3	T	C	18: 30,312,561	S534P	probably benign	Het
Pla2g4e	A	T	2: 120,186,395	C222S	probably benign	Het
Plch1	A	C	3: 63,698,078	H1468Q	probably benign	Het
Psd2	T	A	18: 36,007,503	W610R	probably damaging	Het
Ptgs1	A	T	2: 36,251,186	K548N	probably damaging	Het
Ptprz1	T	A	6: 23,007,355	V1639E	probably damaging	Het
Rangap1	A	T	15: 81,706,494	S466T	probably benign	Het
Rhobtb3	T	C	13: 75,878,895	Y453C	probably damaging	Het
Rspry1	T	C	8: 94,623,008	V8A	probably benign	Het
Rspry1	C	A	8: 94,654,264	R399S	probably benign	Het
Rufy4	T	C	1: 74,147,663	C537R	probably damaging	Het
Rxfp2	A	G	5: 150,070,260	T596A	probably benign	Het
Sap18b	G	A	8: 95,825,370	A3T	unknown	Het
Serpina3j	A	G	12: 104,314,727	D53G	probably damaging	Het
Skint3	T	A	4: 112,298,189	D381E	possibly damaging	Het
Slirp	T	C	12: 87,449,422	S96P	possibly damaging	Het
Snx6	T	C	12: 54,770,728	E128G	probably damaging	Het
Stap1	A	G	5: 86,090,928	T152A	possibly damaging	Het
Tcf20	A	T	15: 82,851,957	N1764K	probably damaging	Het
Thap2	A	T	10: 115,372,839	Y125*	probably null	Het
Ticrr	T	G	7: 79,690,942	Y1031*	probably null	Het
Tnrc18	G	A	5: 142,740,156	R1793C	unknown	Het
Trpm3	C	T	19: 22,926,184	R945*	probably null	Het
Ugt1a10	T	A	1: 88,055,910	D143E	probably damaging	Het
Ush2a	C	T	1: 188,755,206	T3057M	probably benign	Het
Zc3h6	A	T	2: 129,002,156	I207F	possibly damaging	Het
Zfp518a	T	C	19: 40,913,510	S628P	probably benign	Het
Zufsp	T	C	10: 33,927,466	N541D	possibly damaging	Het

Other mutations in Rgsl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01372:Rgsl1	APN	1	153826141	missense	probably damaging	1.00
IGL02253:Rgsl1	APN	1	153793767	missense	probably damaging	1.00
IGL02345:Rgsl1	APN	1	153804009	splice site	probably null
IGL02409:Rgsl1	APN	1	153826243	missense	possibly damaging	0.53
IGL02587:Rgsl1	APN	1	153799938	missense	probably damaging	1.00
IGL02652:Rgsl1	APN	1	153825490	missense	probably damaging	1.00
IGL02797:Rgsl1	APN	1	153807708	missense	probably damaging	1.00
IGL03032:Rgsl1	APN	1	153826202	missense	possibly damaging	0.53
IGL03082:Rgsl1	APN	1	153799947	missense	possibly damaging	0.86
IGL03123:Rgsl1	APN	1	153825941	missense	probably damaging	1.00
IGL03213:Rgsl1	APN	1	153825841	missense	probably benign	0.12
IGL03410:Rgsl1	APN	1	153793755	missense	probably null	0.82
IGL03050:Rgsl1	UTSW	1	153825676	missense	possibly damaging	0.60
PIT4519001:Rgsl1	UTSW	1	153825970	missense	possibly damaging	0.96
R0149:Rgsl1	UTSW	1	153793764	missense	probably damaging	1.00
R0536:Rgsl1	UTSW	1	153826181	missense	probably damaging	1.00
R0633:Rgsl1	UTSW	1	153844107	missense	possibly damaging	0.72
R0726:Rgsl1	UTSW	1	153802328	missense	probably damaging	1.00
R0839:Rgsl1	UTSW	1	153802234	critical splice donor site	probably null
R1240:Rgsl1	UTSW	1	153785191	missense	probably benign	0.18
R1355:Rgsl1	UTSW	1	153807761	start codon destroyed	probably null	0.23
R1491:Rgsl1	UTSW	1	153825926	missense	possibly damaging	0.93
R1688:Rgsl1	UTSW	1	153804676	missense	probably damaging	0.98
R1694:Rgsl1	UTSW	1	153804676	missense	probably damaging	0.98
R1842:Rgsl1	UTSW	1	153799797	missense	probably damaging	1.00
R2008:Rgsl1	UTSW	1	153825905	missense	possibly damaging	0.53
R2114:Rgsl1	UTSW	1	153817549	missense	probably benign
R2116:Rgsl1	UTSW	1	153817549	missense	probably benign
R2176:Rgsl1	UTSW	1	153825268	splice site	probably benign
R2229:Rgsl1	UTSW	1	153822358	missense	possibly damaging	0.72
R2895:Rgsl1	UTSW	1	153827548	missense	probably damaging	1.00
R3923:Rgsl1	UTSW	1	153804130	critical splice acceptor site	probably null
R4001:Rgsl1	UTSW	1	153817584	missense	probably damaging	1.00
R4434:Rgsl1	UTSW	1	153802341	missense	possibly damaging	0.52
R4489:Rgsl1	UTSW	1	153827536	missense	probably benign	0.27
R4649:Rgsl1	UTSW	1	153817582	missense	probably benign	0.01
R4925:Rgsl1	UTSW	1	153812277	missense	probably benign	0.01
R4928:Rgsl1	UTSW	1	153793768	missense	probably damaging	1.00
R5045:Rgsl1	UTSW	1	153821522	nonsense	probably null
R5304:Rgsl1	UTSW	1	153827492	missense	probably damaging	0.97
R5331:Rgsl1	UTSW	1	153802292	missense	probably benign	0.02
R5373:Rgsl1	UTSW	1	153790307	missense	probably benign	0.33
R5566:Rgsl1	UTSW	1	153793774	missense	probably damaging	1.00
R5649:Rgsl1	UTSW	1	153825893	missense	possibly damaging	0.93
R6062:Rgsl1	UTSW	1	153799872	missense	possibly damaging	0.72
R6142:Rgsl1	UTSW	1	153812238	missense	probably benign	0.01
R6158:Rgsl1	UTSW	1	153804021	missense	possibly damaging	0.72
R6184:Rgsl1	UTSW	1	153827448	missense	probably benign	0.08
R6273:Rgsl1	UTSW	1	153827465	missense	possibly damaging	0.96
R6384:Rgsl1	UTSW	1	153827545	missense	possibly damaging	0.86
R6419:Rgsl1	UTSW	1	153822371	missense	probably damaging	0.98
R6568:Rgsl1	UTSW	1	153821546	missense	possibly damaging	0.72
R6660:Rgsl1	UTSW	1	153825766	missense	possibly damaging	0.70
R6745:Rgsl1	UTSW	1	153822317	missense	probably benign	0.18
R6892:Rgsl1	UTSW	1	153821499	nonsense	probably null
R6974:Rgsl1	UTSW	1	153799822	missense	probably damaging	1.00
R7172:Rgsl1	UTSW	1	153826220	missense	possibly damaging	0.72
R7200:Rgsl1	UTSW	1	153785199	missense	probably benign	0.33
R7275:Rgsl1	UTSW	1	153804130	critical splice acceptor site	probably null
R7313:Rgsl1	UTSW	1	153807876	critical splice acceptor site	probably null
R7341:Rgsl1	UTSW	1	153793845	missense	probably benign	0.01
R7448:Rgsl1	UTSW	1	153844101	critical splice donor site	probably null
R7662:Rgsl1	UTSW	1	153825479	missense	probably benign
R7703:Rgsl1	UTSW	1	153793864	missense	possibly damaging	0.73
R7846:Rgsl1	UTSW	1	153826037	missense	possibly damaging	0.53
R8408:Rgsl1	UTSW	1	153825689	missense	possibly damaging	0.96
X0020:Rgsl1	UTSW	1	153825385	missense	probably benign	0.33
X0065:Rgsl1	UTSW	1	153804033	missense	possibly damaging	0.84
Z1177:Rgsl1	UTSW	1	153817610	missense	possibly damaging	0.70
Z1177:Rgsl1	UTSW	1	153825988	missense	not run

Predicted Primers

PCR Primer
(F):5'- TTTCTCTGAGGACCAAGTTAAGG -3'
(R):5'- CATCCCACAGTCTGGATGAC -3'

Sequencing Primer
(F):5'- GACCAAGTTAAGGTGATGACCATTAC -3'
(R):5'- TCTGGATGACTGGACCTACC -3'

Posted On

2016-09-06