Mutagenetix > Incidental Mutation

Incidental Mutation 'R5374:Pla2g4e'

428916

Institutional Source

Beutler Lab

Gene Symbol

Pla2g4e

Ensembl Gene

ENSMUSG00000050211

Gene Name

phospholipase A2, group IVE

Synonyms

Pla2epsilon, 2310026J01Rik

MMRRC Submission

042950-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5374 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

120166412-120245335 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 120186395 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Serine at position 222 (C222S)

Ref Sequence

ENSEMBL: ENSMUSP00000087525 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000090071]

AlphaFold

Q50L42

Predicted Effect

probably benign
Transcript: ENSMUST00000090071
AA Change: C222S

PolyPhen 2 Score 0.304 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000087525
Gene: ENSMUSG00000050211
AA Change: C222S

Domain	Start	End	E-Value	Type
low complexity region	61	73	N/A	INTRINSIC
C2	82	182	3.42e-14	SMART
low complexity region	191	207	N/A	INTRINSIC
PLAc	311	818	5.17e-13	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127009

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000136845

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000152263

Meta Mutation Damage Score

0.1372

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.2%
20x: 95.2%

Validation Efficiency

96% (81/84)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytosolic phospholipase A2 group IV family. Members of this family are involved in regulation of membrane tubule-mediated transport. The enzyme encoded by this member of the family plays a role in trafficking through the clathrin-independent endocytic pathway. The enzyme regulates the recycling process via formation of tubules that transport internalized clathrin-independent cargo proteins back to the cell surface. [provided by RefSeq, Jan 2017]

Allele List at MGI

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110002E22Rik	A	G	3: 138,067,635	S862G	probably benign	Het
2410089E03Rik	T	C	15: 8,270,803	V3198A	unknown	Het
Adgrf1	G	A	17: 43,291,005		probably benign	Het
Adss	T	G	1: 177,796,388	I3L	probably benign	Het
Anapc7	T	A	5: 122,438,217	D302E	probably benign	Het
Ank3	A	G	10: 69,953,476		probably null	Het
Astn2	A	C	4: 65,397,005	V1145G	probably damaging	Het
Babam2	C	T	5: 32,007,230		probably benign	Het
Blvrb	A	G	7: 27,465,846	H238R	possibly damaging	Het
Cacna1b	C	T	2: 24,706,216	V488I	probably damaging	Het
Ccdc88a	C	T	11: 29,463,409	T649M	possibly damaging	Het
Cdh12	A	C	15: 21,583,912	S613R	probably damaging	Het
Cisd2	A	G	3: 135,408,835	V125A	probably benign	Het
Clcn2	C	A	16: 20,709,669	G478W	possibly damaging	Het
Cntnap2	T	A	6: 47,107,969	H1121Q	probably benign	Het
Corin	A	T	5: 72,304,953	C876S	probably damaging	Het
Cox7c	T	C	13: 86,046,620	Y19C	probably benign	Het
Cspp1	T	G	1: 10,134,126	L1038R	probably damaging	Het
Cwc15	A	G	9: 14,504,938	K147E	possibly damaging	Het
Dlgap2	A	G	8: 14,823,614	D739G	probably benign	Het
Dmxl2	A	G	9: 54,369,189		probably benign	Het
Dock5	A	G	14: 67,805,756	V864A	possibly damaging	Het
Dock7	A	G	4: 98,989,038	F1088L	possibly damaging	Het
Dpysl3	T	C	18: 43,361,036	Y193C	probably damaging	Het
Dtna	T	C	18: 23,651,613	Y730H	probably damaging	Het
Dusp3	A	G	11: 101,984,625	Y38H	possibly damaging	Het
Eif3m	A	T	2: 105,012,932	I151N	probably damaging	Het
Entpd2	C	T	2: 25,399,726	T380I	probably damaging	Het
Epb41l3	C	A	17: 69,286,800	H810N	probably damaging	Het
Fcrl5	A	G	3: 87,446,391	T348A	probably benign	Het
Ginm1	A	G	10: 7,779,314	S55P	probably damaging	Het
Glt1d1	C	A	5: 127,657,084		probably null	Het
Gm15433	T	A	1: 84,964,112		noncoding transcript	Het
Gm8221	A	G	15: 77,626,152		noncoding transcript	Het
Gramd1c	A	G	16: 43,983,241	V603A	probably benign	Het
Grm1	A	G	10: 11,080,442	S33P	probably benign	Het
Gstp3	T	C	19: 4,057,922	N137S	possibly damaging	Het
Kdm5d	C	T	Y: 927,995	P756S	probably benign	Het
Ly75	A	T	2: 60,311,771	L1332M	possibly damaging	Het
Med1	T	A	11: 98,163,963	K378N	probably damaging	Het
Mn1	A	G	5: 111,421,886		probably null	Het
Mpo	T	C	11: 87,803,611		probably null	Het
Nom1	C	G	5: 29,441,379	R555G	probably damaging	Het
Nsmce4a	C	T	7: 130,538,170	R276Q	probably benign	Het
Nt5c	G	A	11: 115,490,817		probably null	Het
Olfr472	T	C	7: 107,903,491	I258T	possibly damaging	Het
Olfr670	G	T	7: 104,959,996	H245Q	probably damaging	Het
Olfr908	CACAACAACA	CACAACA	9: 38,516,138		probably benign	Het
Pcdhga4	T	C	18: 37,685,596	V66A	probably damaging	Het
Pik3c3	T	C	18: 30,312,561	S534P	probably benign	Het
Plch1	A	C	3: 63,698,078	H1468Q	probably benign	Het
Psd2	T	A	18: 36,007,503	W610R	probably damaging	Het
Ptgs1	A	T	2: 36,251,186	K548N	probably damaging	Het
Ptprz1	T	A	6: 23,007,355	V1639E	probably damaging	Het
Rangap1	A	T	15: 81,706,494	S466T	probably benign	Het
Rgsl1	C	T	1: 153,790,307	V986I	probably benign	Het
Rhobtb3	T	C	13: 75,878,895	Y453C	probably damaging	Het
Rspry1	T	C	8: 94,623,008	V8A	probably benign	Het
Rspry1	C	A	8: 94,654,264	R399S	probably benign	Het
Rufy4	T	C	1: 74,147,663	C537R	probably damaging	Het
Rxfp2	A	G	5: 150,070,260	T596A	probably benign	Het
Sap18b	G	A	8: 95,825,370	A3T	unknown	Het
Serpina3j	A	G	12: 104,314,727	D53G	probably damaging	Het
Skint3	T	A	4: 112,298,189	D381E	possibly damaging	Het
Slirp	T	C	12: 87,449,422	S96P	possibly damaging	Het
Snx6	T	C	12: 54,770,728	E128G	probably damaging	Het
Stap1	A	G	5: 86,090,928	T152A	possibly damaging	Het
Tcf20	A	T	15: 82,851,957	N1764K	probably damaging	Het
Thap2	A	T	10: 115,372,839	Y125*	probably null	Het
Ticrr	T	G	7: 79,690,942	Y1031*	probably null	Het
Tnrc18	G	A	5: 142,740,156	R1793C	unknown	Het
Trpm3	C	T	19: 22,926,184	R945*	probably null	Het
Ugt1a10	T	A	1: 88,055,910	D143E	probably damaging	Het
Ush2a	C	T	1: 188,755,206	T3057M	probably benign	Het
Zc3h6	A	T	2: 129,002,156	I207F	possibly damaging	Het
Zfp518a	T	C	19: 40,913,510	S628P	probably benign	Het
Zufsp	T	C	10: 33,927,466	N541D	possibly damaging	Het

Other mutations in Pla2g4e

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00470:Pla2g4e	APN	2	120185238	missense	probably benign
IGL01712:Pla2g4e	APN	2	120189403	critical splice donor site	probably null
IGL01859:Pla2g4e	APN	2	120182733	missense	possibly damaging	0.70
IGL02334:Pla2g4e	APN	2	120187236	missense	probably benign
FR4737:Pla2g4e	UTSW	2	120244724	small deletion	probably benign
R0157:Pla2g4e	UTSW	2	120170181	missense	probably benign	0.00
R0578:Pla2g4e	UTSW	2	120244681	splice site	probably benign
R0675:Pla2g4e	UTSW	2	120200198	splice site	probably benign
R1278:Pla2g4e	UTSW	2	120168470	critical splice donor site	probably null
R1346:Pla2g4e	UTSW	2	120182772	missense	probably damaging	1.00
R1760:Pla2g4e	UTSW	2	120170046	missense	possibly damaging	0.50
R1773:Pla2g4e	UTSW	2	120244721	missense	probably benign
R1792:Pla2g4e	UTSW	2	120168474	missense	probably damaging	1.00
R2129:Pla2g4e	UTSW	2	120182811	missense	probably damaging	0.99
R2160:Pla2g4e	UTSW	2	120185206	missense	probably benign	0.00
R2191:Pla2g4e	UTSW	2	120191199	frame shift	probably null
R3901:Pla2g4e	UTSW	2	120168604	missense	probably benign	0.00
R4342:Pla2g4e	UTSW	2	120186446	intron	probably benign
R4414:Pla2g4e	UTSW	2	120182713	missense	probably benign
R4460:Pla2g4e	UTSW	2	120186382	missense	possibly damaging	0.53
R4581:Pla2g4e	UTSW	2	120186382	missense	possibly damaging	0.53
R4599:Pla2g4e	UTSW	2	120186382	missense	possibly damaging	0.53
R4601:Pla2g4e	UTSW	2	120186382	missense	possibly damaging	0.53
R4610:Pla2g4e	UTSW	2	120186382	missense	possibly damaging	0.53
R4611:Pla2g4e	UTSW	2	120186382	missense	possibly damaging	0.53
R4664:Pla2g4e	UTSW	2	120171188	missense	probably damaging	0.97
R4688:Pla2g4e	UTSW	2	120167933	missense	possibly damaging	0.82
R4691:Pla2g4e	UTSW	2	120174300	missense	probably damaging	1.00
R4944:Pla2g4e	UTSW	2	120171237	missense	probably benign	0.01
R5051:Pla2g4e	UTSW	2	120174304	missense	probably damaging	1.00
R5285:Pla2g4e	UTSW	2	120189504	missense	probably damaging	1.00
R5373:Pla2g4e	UTSW	2	120186395	missense	probably benign	0.30
R5505:Pla2g4e	UTSW	2	120244775	missense	probably benign	0.08
R5702:Pla2g4e	UTSW	2	120188511	missense	possibly damaging	0.61
R6300:Pla2g4e	UTSW	2	120182738	missense	probably benign	0.00
R6711:Pla2g4e	UTSW	2	120171270	missense	probably benign	0.00
R6920:Pla2g4e	UTSW	2	120185314	missense	possibly damaging	0.82
R6961:Pla2g4e	UTSW	2	120174370	splice site	probably null
R6987:Pla2g4e	UTSW	2	120186380	missense	probably benign	0.01
R7028:Pla2g4e	UTSW	2	120170195	missense	probably damaging	1.00
R7138:Pla2g4e	UTSW	2	120171278	missense	probably damaging	1.00
R7300:Pla2g4e	UTSW	2	120191199	missense	probably damaging	1.00
R7355:Pla2g4e	UTSW	2	120181501	missense	possibly damaging	0.91
R7502:Pla2g4e	UTSW	2	120174338	splice site	probably null
R7849:Pla2g4e	UTSW	2	120185322	missense	probably benign	0.32
R8288:Pla2g4e	UTSW	2	120188509	critical splice donor site	probably null
R8686:Pla2g4e	UTSW	2	120244691	missense	probably damaging	0.98
R9003:Pla2g4e	UTSW	2	120176801	missense	probably benign	0.03
R9023:Pla2g4e	UTSW	2	120171237	missense	probably benign	0.01
R9261:Pla2g4e	UTSW	2	120189429	missense	probably benign	0.04
R9284:Pla2g4e	UTSW	2	120174249	splice site	probably benign
R9299:Pla2g4e	UTSW	2	120171723	missense	probably damaging	1.00
R9338:Pla2g4e	UTSW	2	120189433	missense	probably benign	0.07
R9555:Pla2g4e	UTSW	2	120244919	start gained	probably benign
R9604:Pla2g4e	UTSW	2	120185199	missense	probably benign	0.02
RF044:Pla2g4e	UTSW	2	120244724	small deletion	probably benign
Z1177:Pla2g4e	UTSW	2	120181523	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- TGGATCCCTGGAAGAACAAAC -3'
(R):5'- CCTTGACTGGGTTCAGAATTGTC -3'

Sequencing Primer
(F):5'- GACGTCTGAAGACACGATTTTG -3'
(R):5'- GACTGGGTTCAGAATTGTCTACACC -3'

Posted On

2016-09-06