Incidental Mutation 'R5374:Anapc7'
ID 428930
Institutional Source Beutler Lab
Gene Symbol Anapc7
Ensembl Gene ENSMUSG00000029466
Gene Name anaphase promoting complex subunit 7
Synonyms prediabetic NOD sera-reactive autoantigen, APC7
MMRRC Submission 042950-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.958) question?
Stock # R5374 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 122559756-122582975 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 122576280 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 302 (D302E)
Ref Sequence ENSEMBL: ENSMUSP00000112658 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031422] [ENSMUST00000119792] [ENSMUST00000122010]
AlphaFold Q9WVM3
Predicted Effect probably benign
Transcript: ENSMUST00000031422
AA Change: D302E

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000031422
Gene: ENSMUSG00000029466
AA Change: D302E

DomainStartEndE-ValueType
low complexity region 15 33 N/A INTRINSIC
TPR 135 168 7.11e1 SMART
TPR 237 270 1.29e1 SMART
TPR 339 372 2.22e-2 SMART
TPR 475 508 4.09e-1 SMART
low complexity region 530 551 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000116022
Predicted Effect probably benign
Transcript: ENSMUST00000119792
AA Change: D302E

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000112658
Gene: ENSMUSG00000029466
AA Change: D302E

DomainStartEndE-ValueType
low complexity region 15 33 N/A INTRINSIC
TPR 135 168 7.11e1 SMART
TPR 237 270 1.29e1 SMART
TPR 339 372 2.22e-2 SMART
TPR 442 475 5.76e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000122010
AA Change: D302E

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000113928
Gene: ENSMUSG00000029466
AA Change: D302E

DomainStartEndE-ValueType
low complexity region 15 33 N/A INTRINSIC
TPR 135 168 7.11e1 SMART
TPR 237 270 1.29e1 SMART
TPR 339 372 2.22e-2 SMART
TPR 475 508 4.09e-1 SMART
low complexity region 530 551 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148266
Predicted Effect probably benign
Transcript: ENSMUST00000154074
SMART Domains Protein: ENSMUSP00000123365
Gene: ENSMUSG00000029466

DomainStartEndE-ValueType
Blast:TPR 2 28 2e-8 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197993
Meta Mutation Damage Score 0.0893 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 96% (81/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a tetratricopeptide repeat containing component of the anaphase promoting complex/cyclosome (APC/C), a large E3 ubiquitin ligase that controls cell cycle progression by targeting a number of cell cycle regulators such as B-type cyclins for 26S proteasome-mediated degradation through ubiquitination. The encoded protein is required for proper protein ubiquitination function of APC/C and for the interaction of APC/C with certain transcription coactivators. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2008]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 137,773,396 (GRCm39) S862G probably benign Het
Adgrf1 G A 17: 43,601,896 (GRCm39) probably benign Het
Adss2 T G 1: 177,623,954 (GRCm39) I3L probably benign Het
Ank3 A G 10: 69,789,306 (GRCm39) probably null Het
Astn2 A C 4: 65,315,242 (GRCm39) V1145G probably damaging Het
Babam2 C T 5: 32,164,574 (GRCm39) probably benign Het
Blvrb A G 7: 27,165,271 (GRCm39) H238R possibly damaging Het
Cacna1b C T 2: 24,596,228 (GRCm39) V488I probably damaging Het
Ccdc88a C T 11: 29,413,409 (GRCm39) T649M possibly damaging Het
Cdh12 A C 15: 21,583,998 (GRCm39) S613R probably damaging Het
Cisd2 A G 3: 135,114,596 (GRCm39) V125A probably benign Het
Clcn2 C A 16: 20,528,419 (GRCm39) G478W possibly damaging Het
Cntnap2 T A 6: 47,084,903 (GRCm39) H1121Q probably benign Het
Corin A T 5: 72,462,296 (GRCm39) C876S probably damaging Het
Cox7c T C 13: 86,194,739 (GRCm39) Y19C probably benign Het
Cplane1 T C 15: 8,300,287 (GRCm39) V3198A unknown Het
Cspp1 T G 1: 10,204,351 (GRCm39) L1038R probably damaging Het
Cwc15 A G 9: 14,416,234 (GRCm39) K147E possibly damaging Het
Dlgap2 A G 8: 14,873,614 (GRCm39) D739G probably benign Het
Dmxl2 A G 9: 54,276,473 (GRCm39) probably benign Het
Dock5 A G 14: 68,043,205 (GRCm39) V864A possibly damaging Het
Dock7 A G 4: 98,877,275 (GRCm39) F1088L possibly damaging Het
Dpysl3 T C 18: 43,494,101 (GRCm39) Y193C probably damaging Het
Dtna T C 18: 23,784,670 (GRCm39) Y730H probably damaging Het
Dusp3 A G 11: 101,875,451 (GRCm39) Y38H possibly damaging Het
Eif3m A T 2: 104,843,277 (GRCm39) I151N probably damaging Het
Entpd2 C T 2: 25,289,738 (GRCm39) T380I probably damaging Het
Epb41l3 C A 17: 69,593,795 (GRCm39) H810N probably damaging Het
Fcrl5 A G 3: 87,353,698 (GRCm39) T348A probably benign Het
Ginm1 A G 10: 7,655,078 (GRCm39) S55P probably damaging Het
Glt1d1 C A 5: 127,734,148 (GRCm39) probably null Het
Gm15433 T A 1: 84,941,833 (GRCm39) noncoding transcript Het
Gm8221 A G 15: 77,510,352 (GRCm39) noncoding transcript Het
Gramd1c A G 16: 43,803,604 (GRCm39) V603A probably benign Het
Grm1 A G 10: 10,956,186 (GRCm39) S33P probably benign Het
Gstp3 T C 19: 4,107,922 (GRCm39) N137S possibly damaging Het
Kdm5d C T Y: 927,995 (GRCm39) P756S probably benign Het
Ly75 A T 2: 60,142,115 (GRCm39) L1332M possibly damaging Het
Med1 T A 11: 98,054,789 (GRCm39) K378N probably damaging Het
Mn1 A G 5: 111,569,752 (GRCm39) probably null Het
Mpo T C 11: 87,694,437 (GRCm39) probably null Het
Nom1 C G 5: 29,646,377 (GRCm39) R555G probably damaging Het
Nsmce4a C T 7: 130,139,900 (GRCm39) R276Q probably benign Het
Nt5c G A 11: 115,381,643 (GRCm39) probably null Het
Olfr908 CACAACAACA CACAACA 9: 38,427,434 (GRCm39) probably benign Het
Or52e18 G T 7: 104,609,203 (GRCm39) H245Q probably damaging Het
Or5p52 T C 7: 107,502,698 (GRCm39) I258T possibly damaging Het
Pcdhga4 T C 18: 37,818,649 (GRCm39) V66A probably damaging Het
Pik3c3 T C 18: 30,445,614 (GRCm39) S534P probably benign Het
Pla2g4e A T 2: 120,016,876 (GRCm39) C222S probably benign Het
Plch1 A C 3: 63,605,499 (GRCm39) H1468Q probably benign Het
Psd2 T A 18: 36,140,556 (GRCm39) W610R probably damaging Het
Ptgs1 A T 2: 36,141,198 (GRCm39) K548N probably damaging Het
Ptprz1 T A 6: 23,007,354 (GRCm39) V1639E probably damaging Het
Rangap1 A T 15: 81,590,695 (GRCm39) S466T probably benign Het
Rgsl1 C T 1: 153,666,053 (GRCm39) V986I probably benign Het
Rhobtb3 T C 13: 76,027,014 (GRCm39) Y453C probably damaging Het
Rspry1 T C 8: 95,349,636 (GRCm39) V8A probably benign Het
Rspry1 C A 8: 95,380,892 (GRCm39) R399S probably benign Het
Rufy4 T C 1: 74,186,822 (GRCm39) C537R probably damaging Het
Rxfp2 A G 5: 149,993,725 (GRCm39) T596A probably benign Het
Sap18b G A 8: 96,551,998 (GRCm39) A3T unknown Het
Serpina3j A G 12: 104,280,986 (GRCm39) D53G probably damaging Het
Skint3 T A 4: 112,155,386 (GRCm39) D381E possibly damaging Het
Slirp T C 12: 87,496,192 (GRCm39) S96P possibly damaging Het
Snx6 T C 12: 54,817,513 (GRCm39) E128G probably damaging Het
Stap1 A G 5: 86,238,787 (GRCm39) T152A possibly damaging Het
Tcf20 A T 15: 82,736,158 (GRCm39) N1764K probably damaging Het
Thap2 A T 10: 115,208,744 (GRCm39) Y125* probably null Het
Ticrr T G 7: 79,340,690 (GRCm39) Y1031* probably null Het
Tnrc18 G A 5: 142,725,911 (GRCm39) R1793C unknown Het
Trpm3 C T 19: 22,903,548 (GRCm39) R945* probably null Het
Ugt1a10 T A 1: 87,983,632 (GRCm39) D143E probably damaging Het
Ush2a C T 1: 188,487,403 (GRCm39) T3057M probably benign Het
Zc3h6 A T 2: 128,844,076 (GRCm39) I207F possibly damaging Het
Zfp518a T C 19: 40,901,954 (GRCm39) S628P probably benign Het
Zup1 T C 10: 33,803,462 (GRCm39) N541D possibly damaging Het
Other mutations in Anapc7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00823:Anapc7 APN 5 122,571,540 (GRCm39) nonsense probably null
IGL01434:Anapc7 APN 5 122,576,279 (GRCm39) missense probably benign 0.45
IGL01448:Anapc7 APN 5 122,566,276 (GRCm39) missense probably damaging 1.00
IGL01862:Anapc7 APN 5 122,578,182 (GRCm39) missense probably benign
IGL03040:Anapc7 APN 5 122,571,450 (GRCm39) nonsense probably null
IGL03268:Anapc7 APN 5 122,567,669 (GRCm39) critical splice donor site probably null
R0603:Anapc7 UTSW 5 122,578,233 (GRCm39) missense probably benign 0.40
R1497:Anapc7 UTSW 5 122,573,578 (GRCm39) splice site probably benign
R1889:Anapc7 UTSW 5 122,571,539 (GRCm39) missense probably damaging 1.00
R1990:Anapc7 UTSW 5 122,577,567 (GRCm39) missense probably benign 0.38
R2149:Anapc7 UTSW 5 122,581,889 (GRCm39) missense probably benign 0.41
R2877:Anapc7 UTSW 5 122,566,219 (GRCm39) missense probably benign 0.35
R3835:Anapc7 UTSW 5 122,581,940 (GRCm39) missense possibly damaging 0.83
R4963:Anapc7 UTSW 5 122,560,669 (GRCm39) missense probably damaging 0.97
R5373:Anapc7 UTSW 5 122,576,280 (GRCm39) missense probably benign 0.01
R5973:Anapc7 UTSW 5 122,566,366 (GRCm39) missense probably benign
R6911:Anapc7 UTSW 5 122,578,343 (GRCm39) nonsense probably null
R7287:Anapc7 UTSW 5 122,571,499 (GRCm39) missense probably benign 0.08
R8375:Anapc7 UTSW 5 122,566,342 (GRCm39) missense probably benign 0.05
R8700:Anapc7 UTSW 5 122,560,669 (GRCm39) missense probably damaging 0.97
R8744:Anapc7 UTSW 5 122,566,211 (GRCm39) missense probably benign 0.03
R9634:Anapc7 UTSW 5 122,560,689 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GAGATACACGTGGTTGTGAGC -3'
(R):5'- TTACAGCTACAAGCCAGAGATC -3'

Sequencing Primer
(F):5'- TGGTTGTGAGCCACCACTG -3'
(R):5'- CAGCTACAAGCCAGAGATCAGTAAAG -3'
Posted On 2016-09-06