Mutagenetix > Incidental Mutation

Incidental Mutation 'R5374:Cntnap2'

428935

Institutional Source

Beutler Lab

Gene Symbol

Cntnap2

Ensembl Gene

ENSMUSG00000039419

Gene Name

contactin associated protein-like 2

Synonyms

5430425M22Rik, Caspr2

MMRRC Submission

042950-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5374 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

45059357-47304213 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 47107969 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Glutamine at position 1121 (H1121Q)

Ref Sequence

ENSEMBL: ENSMUSP00000110288 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000114641]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000114641
AA Change: H1121Q

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000110288
Gene: ENSMUSG00000039419
AA Change: H1121Q

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
FA58C	34	181	3.99e-22	SMART
LamG	208	345	5.5e-34	SMART
LamG	393	529	3.31e-28	SMART
EGF	557	591	5.04e-2	SMART
Blast:FBG	594	777	7e-68	BLAST
LamG	819	945	5.58e-35	SMART
EGF	966	1002	2.11e1	SMART
LamG	1048	1188	3.55e-28	SMART
low complexity region	1263	1273	N/A	INTRINSIC
4.1m	1283	1301	4.21e-7	SMART

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.2%
20x: 95.2%

Validation Efficiency

96% (81/84)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the neurexin family which functions in the vertebrate nervous system as cell adhesion molecules and receptors. This protein, like other neurexin proteins, contains epidermal growth factor repeats and laminin G domains. In addition, it includes an F5/8 type C domain, discoidin/neuropilin- and fibrinogen-like domains, thrombospondin N-terminal-like domains and a putative PDZ binding site. This protein is localized at the juxtaparanodes of myelinated axons, and mediates interactions between neurons and glia during nervous system development and is also involved in localization of potassium channels within differentiating axons. This gene encompasses almost 1.5% of chromosome 7 and is one of the largest genes in the human genome. It is directly bound and regulated by forkhead box protein P2 (FOXP2), a transcription factor related to speech and language development. This gene has been implicated in multiple neurodevelopmental disorders, including Gilles de la Tourette syndrome, schizophrenia, epilepsy, autism, ADHD and mental retardation.[provided by RefSeq, Mar 2010]
PHENOTYPE: Inactivation of this gene results in molecular abnormalities within the central nervous system, but homozygous mutant mice show no overt phenotype. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110002E22Rik	A	G	3: 138,067,635	S862G	probably benign	Het
2410089E03Rik	T	C	15: 8,270,803	V3198A	unknown	Het
Adgrf1	G	A	17: 43,291,005		probably benign	Het
Adss	T	G	1: 177,796,388	I3L	probably benign	Het
Anapc7	T	A	5: 122,438,217	D302E	probably benign	Het
Ank3	A	G	10: 69,953,476		probably null	Het
Astn2	A	C	4: 65,397,005	V1145G	probably damaging	Het
Babam2	C	T	5: 32,007,230		probably benign	Het
Blvrb	A	G	7: 27,465,846	H238R	possibly damaging	Het
Cacna1b	C	T	2: 24,706,216	V488I	probably damaging	Het
Ccdc88a	C	T	11: 29,463,409	T649M	possibly damaging	Het
Cdh12	A	C	15: 21,583,912	S613R	probably damaging	Het
Cisd2	A	G	3: 135,408,835	V125A	probably benign	Het
Clcn2	C	A	16: 20,709,669	G478W	possibly damaging	Het
Corin	A	T	5: 72,304,953	C876S	probably damaging	Het
Cox7c	T	C	13: 86,046,620	Y19C	probably benign	Het
Cspp1	T	G	1: 10,134,126	L1038R	probably damaging	Het
Cwc15	A	G	9: 14,504,938	K147E	possibly damaging	Het
Dlgap2	A	G	8: 14,823,614	D739G	probably benign	Het
Dmxl2	A	G	9: 54,369,189		probably benign	Het
Dock5	A	G	14: 67,805,756	V864A	possibly damaging	Het
Dock7	A	G	4: 98,989,038	F1088L	possibly damaging	Het
Dpysl3	T	C	18: 43,361,036	Y193C	probably damaging	Het
Dtna	T	C	18: 23,651,613	Y730H	probably damaging	Het
Dusp3	A	G	11: 101,984,625	Y38H	possibly damaging	Het
Eif3m	A	T	2: 105,012,932	I151N	probably damaging	Het
Entpd2	C	T	2: 25,399,726	T380I	probably damaging	Het
Epb41l3	C	A	17: 69,286,800	H810N	probably damaging	Het
Fcrl5	A	G	3: 87,446,391	T348A	probably benign	Het
Ginm1	A	G	10: 7,779,314	S55P	probably damaging	Het
Glt1d1	C	A	5: 127,657,084		probably null	Het
Gm15433	T	A	1: 84,964,112		noncoding transcript	Het
Gm8221	A	G	15: 77,626,152		noncoding transcript	Het
Gramd1c	A	G	16: 43,983,241	V603A	probably benign	Het
Grm1	A	G	10: 11,080,442	S33P	probably benign	Het
Gstp3	T	C	19: 4,057,922	N137S	possibly damaging	Het
Kdm5d	C	T	Y: 927,995	P756S	probably benign	Het
Ly75	A	T	2: 60,311,771	L1332M	possibly damaging	Het
Med1	T	A	11: 98,163,963	K378N	probably damaging	Het
Mn1	A	G	5: 111,421,886		probably null	Het
Mpo	T	C	11: 87,803,611		probably null	Het
Nom1	C	G	5: 29,441,379	R555G	probably damaging	Het
Nsmce4a	C	T	7: 130,538,170	R276Q	probably benign	Het
Nt5c	G	A	11: 115,490,817		probably null	Het
Olfr472	T	C	7: 107,903,491	I258T	possibly damaging	Het
Olfr670	G	T	7: 104,959,996	H245Q	probably damaging	Het
Olfr908	CACAACAACA	CACAACA	9: 38,516,138		probably benign	Het
Pcdhga4	T	C	18: 37,685,596	V66A	probably damaging	Het
Pik3c3	T	C	18: 30,312,561	S534P	probably benign	Het
Pla2g4e	A	T	2: 120,186,395	C222S	probably benign	Het
Plch1	A	C	3: 63,698,078	H1468Q	probably benign	Het
Psd2	T	A	18: 36,007,503	W610R	probably damaging	Het
Ptgs1	A	T	2: 36,251,186	K548N	probably damaging	Het
Ptprz1	T	A	6: 23,007,355	V1639E	probably damaging	Het
Rangap1	A	T	15: 81,706,494	S466T	probably benign	Het
Rgsl1	C	T	1: 153,790,307	V986I	probably benign	Het
Rhobtb3	T	C	13: 75,878,895	Y453C	probably damaging	Het
Rspry1	T	C	8: 94,623,008	V8A	probably benign	Het
Rspry1	C	A	8: 94,654,264	R399S	probably benign	Het
Rufy4	T	C	1: 74,147,663	C537R	probably damaging	Het
Rxfp2	A	G	5: 150,070,260	T596A	probably benign	Het
Sap18b	G	A	8: 95,825,370	A3T	unknown	Het
Serpina3j	A	G	12: 104,314,727	D53G	probably damaging	Het
Skint3	T	A	4: 112,298,189	D381E	possibly damaging	Het
Slirp	T	C	12: 87,449,422	S96P	possibly damaging	Het
Snx6	T	C	12: 54,770,728	E128G	probably damaging	Het
Stap1	A	G	5: 86,090,928	T152A	possibly damaging	Het
Tcf20	A	T	15: 82,851,957	N1764K	probably damaging	Het
Thap2	A	T	10: 115,372,839	Y125*	probably null	Het
Ticrr	T	G	7: 79,690,942	Y1031*	probably null	Het
Tnrc18	G	A	5: 142,740,156	R1793C	unknown	Het
Trpm3	C	T	19: 22,926,184	R945*	probably null	Het
Ugt1a10	T	A	1: 88,055,910	D143E	probably damaging	Het
Ush2a	C	T	1: 188,755,206	T3057M	probably benign	Het
Zc3h6	A	T	2: 129,002,156	I207F	possibly damaging	Het
Zfp518a	T	C	19: 40,913,510	S628P	probably benign	Het
Zufsp	T	C	10: 33,927,466	N541D	possibly damaging	Het

Other mutations in Cntnap2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00509:Cntnap2	APN	6	46015263	missense	possibly damaging	0.92
IGL00657:Cntnap2	APN	6	46988787	missense	probably damaging	0.98
IGL00846:Cntnap2	APN	6	47193038	missense	probably benign	0.12
IGL00851:Cntnap2	APN	6	46484072	missense	probably benign
IGL00857:Cntnap2	APN	6	47049424	missense	probably benign	0.00
IGL01290:Cntnap2	APN	6	46015465	missense	probably benign	0.06
IGL01445:Cntnap2	APN	6	47193013	missense	probably benign	0.14
IGL01468:Cntnap2	APN	6	47271371	nonsense	probably null
IGL01859:Cntnap2	APN	6	46988721	missense	probably damaging	1.00
IGL02092:Cntnap2	APN	6	46234203	missense	probably damaging	1.00
IGL02239:Cntnap2	APN	6	47021654	missense	probably damaging	0.99
IGL02508:Cntnap2	APN	6	46234320	missense	probably damaging	1.00
IGL02530:Cntnap2	APN	6	47021736	missense	possibly damaging	0.48
IGL03013:Cntnap2	APN	6	47095549	missense	possibly damaging	0.66
BB004:Cntnap2	UTSW	6	47095687	missense	possibly damaging	0.93
BB014:Cntnap2	UTSW	6	47095687	missense	possibly damaging	0.93
IGL02802:Cntnap2	UTSW	6	46170245	missense	probably damaging	1.00
R0001:Cntnap2	UTSW	6	46530171	missense	probably benign	0.04
R0007:Cntnap2	UTSW	6	45992073	missense	possibly damaging	0.95
R0007:Cntnap2	UTSW	6	45992073	missense	possibly damaging	0.95
R0043:Cntnap2	UTSW	6	46483983	missense	probably benign	0.01
R0118:Cntnap2	UTSW	6	45060392	splice site	probably null
R0352:Cntnap2	UTSW	6	45992084	splice site	probably null
R0389:Cntnap2	UTSW	6	46009637	missense	probably benign	0.06
R0482:Cntnap2	UTSW	6	45715816	missense	probably benign	0.00
R0530:Cntnap2	UTSW	6	46529905	nonsense	probably null
R0611:Cntnap2	UTSW	6	47095549	missense	possibly damaging	0.66
R0630:Cntnap2	UTSW	6	46988760	missense	probably damaging	0.99
R0636:Cntnap2	UTSW	6	47296708	splice site	probably benign
R0976:Cntnap2	UTSW	6	47271230	missense	probably damaging	1.00
R1195:Cntnap2	UTSW	6	46483968	missense	probably benign
R1195:Cntnap2	UTSW	6	46483968	missense	probably benign
R1195:Cntnap2	UTSW	6	46483968	missense	probably benign
R1387:Cntnap2	UTSW	6	47107914	missense	probably benign	0.19
R1524:Cntnap2	UTSW	6	46530679	missense	probably damaging	1.00
R1609:Cntnap2	UTSW	6	46015330	missense	probably benign	0.13
R1716:Cntnap2	UTSW	6	47107892	nonsense	probably null
R1757:Cntnap2	UTSW	6	46759829	missense	probably damaging	1.00
R1809:Cntnap2	UTSW	6	46988675	missense	probably damaging	0.99
R1813:Cntnap2	UTSW	6	46530633	missense	probably damaging	1.00
R2103:Cntnap2	UTSW	6	47298588	missense	probably damaging	1.00
R2133:Cntnap2	UTSW	6	47298445	missense	probably damaging	1.00
R3037:Cntnap2	UTSW	6	46015266	missense	possibly damaging	0.57
R3899:Cntnap2	UTSW	6	45991903	missense	probably benign	0.00
R4027:Cntnap2	UTSW	6	46856128	missense	probably benign
R4030:Cntnap2	UTSW	6	46856128	missense	probably benign
R4237:Cntnap2	UTSW	6	46530390	intron	probably benign
R4445:Cntnap2	UTSW	6	46759851	missense	probably benign	0.01
R4737:Cntnap2	UTSW	6	45060317	missense	possibly damaging	0.65
R4740:Cntnap2	UTSW	6	45060317	missense	possibly damaging	0.65
R4915:Cntnap2	UTSW	6	46530035	intron	probably benign
R4918:Cntnap2	UTSW	6	46530035	intron	probably benign
R4999:Cntnap2	UTSW	6	45920834	missense	probably damaging	0.96
R5373:Cntnap2	UTSW	6	47107969	missense	probably benign	0.00
R5742:Cntnap2	UTSW	6	45920926	nonsense	probably null
R5748:Cntnap2	UTSW	6	45715884	missense	probably damaging	1.00
R5765:Cntnap2	UTSW	6	46529815	intron	probably benign
R6118:Cntnap2	UTSW	6	47193077	missense	possibly damaging	0.81
R6181:Cntnap2	UTSW	6	46759808	missense	probably damaging	1.00
R6189:Cntnap2	UTSW	6	47271298	missense	probably damaging	1.00
R6262:Cntnap2	UTSW	6	45060112	splice site	probably null
R6385:Cntnap2	UTSW	6	46856180	missense	probably benign	0.00
R6555:Cntnap2	UTSW	6	46759760	missense	probably damaging	1.00
R6577:Cntnap2	UTSW	6	46170272	missense	probably benign	0.25
R6610:Cntnap2	UTSW	6	46015257	missense	probably benign	0.08
R6761:Cntnap2	UTSW	6	47049373	missense	probably benign	0.03
R7125:Cntnap2	UTSW	6	46988646	missense	probably benign	0.12
R7329:Cntnap2	UTSW	6	47271271	missense	possibly damaging	0.94
R7502:Cntnap2	UTSW	6	46484029	missense	possibly damaging	0.83
R7927:Cntnap2	UTSW	6	47095687	missense	possibly damaging	0.93
R8057:Cntnap2	UTSW	6	46347145	missense	probably damaging	0.98
R8261:Cntnap2	UTSW	6	47095693	missense	probably damaging	0.98
R8356:Cntnap2	UTSW	6	47049373	missense	probably benign	0.03
R8479:Cntnap2	UTSW	6	46759773	missense	probably benign	0.14
R8503:Cntnap2	UTSW	6	45992041	missense	probably damaging	1.00
R8698:Cntnap2	UTSW	6	47049222	missense	probably damaging	1.00
R8719:Cntnap2	UTSW	6	46001227	missense	probably damaging	1.00
R8816:Cntnap2	UTSW	6	46856142	missense	possibly damaging	0.72
R8987:Cntnap2	UTSW	6	46484049	missense	probably benign	0.01
R9000:Cntnap2	UTSW	6	46484205	intron	probably benign
R9209:Cntnap2	UTSW	6	47049249	missense	probably damaging	1.00
R9253:Cntnap2	UTSW	6	46001178	missense	probably benign	0.00
R9310:Cntnap2	UTSW	6	46001347	missense	probably damaging	1.00
R9395:Cntnap2	UTSW	6	46001310	missense	probably damaging	0.98
R9462:Cntnap2	UTSW	6	46234283	missense	probably damaging	0.99
R9526:Cntnap2	UTSW	6	46015231	missense	probably damaging	1.00
R9600:Cntnap2	UTSW	6	45992075	missense	probably damaging	0.98
R9621:Cntnap2	UTSW	6	46988792	missense	probably damaging	0.98
R9738:Cntnap2	UTSW	6	46015439	frame shift	probably null
R9745:Cntnap2	UTSW	6	46234166	missense	probably benign	0.01
R9775:Cntnap2	UTSW	6	47049327	missense	probably damaging	1.00
RF022:Cntnap2	UTSW	6	47021665	missense	probably damaging	1.00
X0018:Cntnap2	UTSW	6	46009518	missense	possibly damaging	0.53
X0063:Cntnap2	UTSW	6	47021754	missense	possibly damaging	0.92
X0066:Cntnap2	UTSW	6	46234245	missense	probably benign	0.03
Z1176:Cntnap2	UTSW	6	47271148	missense	probably benign	0.00
Z1177:Cntnap2	UTSW	6	46015299	missense	possibly damaging	0.90

Predicted Primers

PCR Primer
(F):5'- TGAGATGGCATTGAAATACACTTCC -3'
(R):5'- GCAACTTAATGATATCCTGCCAC -3'

Sequencing Primer
(F):5'- GAACCAGAGAGCCATTCA -3'
(R):5'- GCTTGACTTAGCATATGCAAGGACC -3'

Posted On

2016-09-06