Incidental Mutation 'R5374:Ticrr'
ID 428937
Institutional Source Beutler Lab
Gene Symbol Ticrr
Ensembl Gene ENSMUSG00000046591
Gene Name TOPBP1-interacting checkpoint and replication regulator
Synonyms 5730590G19Rik
MMRRC Submission 042950-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.949) question?
Stock # R5374 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 79309944-79347896 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) T to G at 79340690 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 1031 (Y1031*)
Ref Sequence ENSEMBL: ENSMUSP00000041377 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035977] [ENSMUST00000206591] [ENSMUST00000206622]
AlphaFold Q8BQ33
Predicted Effect probably null
Transcript: ENSMUST00000035977
AA Change: Y1031*
SMART Domains Protein: ENSMUSP00000041377
Gene: ENSMUSG00000046591
AA Change: Y1031*

DomainStartEndE-ValueType
low complexity region 23 31 N/A INTRINSIC
Pfam:Treslin_N 211 1005 N/A PFAM
low complexity region 1186 1197 N/A INTRINSIC
low complexity region 1220 1235 N/A INTRINSIC
low complexity region 1339 1359 N/A INTRINSIC
low complexity region 1472 1480 N/A INTRINSIC
low complexity region 1496 1514 N/A INTRINSIC
low complexity region 1630 1643 N/A INTRINSIC
low complexity region 1694 1707 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000206591
Predicted Effect probably benign
Transcript: ENSMUST00000206622
Meta Mutation Damage Score 0.9707 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 96% (81/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Treslin is involved in the initiation of DNA replication (Kumagai et al., 2010 [PubMed 20116089]).[supplied by OMIM, Apr 2010]
PHENOTYPE: Mice homozygous for an ENU-induced allele are mostly hairless, with only a light patch of hair around the face and tail. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 137,773,396 (GRCm39) S862G probably benign Het
Adgrf1 G A 17: 43,601,896 (GRCm39) probably benign Het
Adss2 T G 1: 177,623,954 (GRCm39) I3L probably benign Het
Anapc7 T A 5: 122,576,280 (GRCm39) D302E probably benign Het
Ank3 A G 10: 69,789,306 (GRCm39) probably null Het
Astn2 A C 4: 65,315,242 (GRCm39) V1145G probably damaging Het
Babam2 C T 5: 32,164,574 (GRCm39) probably benign Het
Blvrb A G 7: 27,165,271 (GRCm39) H238R possibly damaging Het
Cacna1b C T 2: 24,596,228 (GRCm39) V488I probably damaging Het
Ccdc88a C T 11: 29,413,409 (GRCm39) T649M possibly damaging Het
Cdh12 A C 15: 21,583,998 (GRCm39) S613R probably damaging Het
Cisd2 A G 3: 135,114,596 (GRCm39) V125A probably benign Het
Clcn2 C A 16: 20,528,419 (GRCm39) G478W possibly damaging Het
Cntnap2 T A 6: 47,084,903 (GRCm39) H1121Q probably benign Het
Corin A T 5: 72,462,296 (GRCm39) C876S probably damaging Het
Cox7c T C 13: 86,194,739 (GRCm39) Y19C probably benign Het
Cplane1 T C 15: 8,300,287 (GRCm39) V3198A unknown Het
Cspp1 T G 1: 10,204,351 (GRCm39) L1038R probably damaging Het
Cwc15 A G 9: 14,416,234 (GRCm39) K147E possibly damaging Het
Dlgap2 A G 8: 14,873,614 (GRCm39) D739G probably benign Het
Dmxl2 A G 9: 54,276,473 (GRCm39) probably benign Het
Dock5 A G 14: 68,043,205 (GRCm39) V864A possibly damaging Het
Dock7 A G 4: 98,877,275 (GRCm39) F1088L possibly damaging Het
Dpysl3 T C 18: 43,494,101 (GRCm39) Y193C probably damaging Het
Dtna T C 18: 23,784,670 (GRCm39) Y730H probably damaging Het
Dusp3 A G 11: 101,875,451 (GRCm39) Y38H possibly damaging Het
Eif3m A T 2: 104,843,277 (GRCm39) I151N probably damaging Het
Entpd2 C T 2: 25,289,738 (GRCm39) T380I probably damaging Het
Epb41l3 C A 17: 69,593,795 (GRCm39) H810N probably damaging Het
Fcrl5 A G 3: 87,353,698 (GRCm39) T348A probably benign Het
Ginm1 A G 10: 7,655,078 (GRCm39) S55P probably damaging Het
Glt1d1 C A 5: 127,734,148 (GRCm39) probably null Het
Gm15433 T A 1: 84,941,833 (GRCm39) noncoding transcript Het
Gm8221 A G 15: 77,510,352 (GRCm39) noncoding transcript Het
Gramd1c A G 16: 43,803,604 (GRCm39) V603A probably benign Het
Grm1 A G 10: 10,956,186 (GRCm39) S33P probably benign Het
Gstp3 T C 19: 4,107,922 (GRCm39) N137S possibly damaging Het
Kdm5d C T Y: 927,995 (GRCm39) P756S probably benign Het
Ly75 A T 2: 60,142,115 (GRCm39) L1332M possibly damaging Het
Med1 T A 11: 98,054,789 (GRCm39) K378N probably damaging Het
Mn1 A G 5: 111,569,752 (GRCm39) probably null Het
Mpo T C 11: 87,694,437 (GRCm39) probably null Het
Nom1 C G 5: 29,646,377 (GRCm39) R555G probably damaging Het
Nsmce4a C T 7: 130,139,900 (GRCm39) R276Q probably benign Het
Nt5c G A 11: 115,381,643 (GRCm39) probably null Het
Olfr908 CACAACAACA CACAACA 9: 38,427,434 (GRCm39) probably benign Het
Or52e18 G T 7: 104,609,203 (GRCm39) H245Q probably damaging Het
Or5p52 T C 7: 107,502,698 (GRCm39) I258T possibly damaging Het
Pcdhga4 T C 18: 37,818,649 (GRCm39) V66A probably damaging Het
Pik3c3 T C 18: 30,445,614 (GRCm39) S534P probably benign Het
Pla2g4e A T 2: 120,016,876 (GRCm39) C222S probably benign Het
Plch1 A C 3: 63,605,499 (GRCm39) H1468Q probably benign Het
Psd2 T A 18: 36,140,556 (GRCm39) W610R probably damaging Het
Ptgs1 A T 2: 36,141,198 (GRCm39) K548N probably damaging Het
Ptprz1 T A 6: 23,007,354 (GRCm39) V1639E probably damaging Het
Rangap1 A T 15: 81,590,695 (GRCm39) S466T probably benign Het
Rgsl1 C T 1: 153,666,053 (GRCm39) V986I probably benign Het
Rhobtb3 T C 13: 76,027,014 (GRCm39) Y453C probably damaging Het
Rspry1 T C 8: 95,349,636 (GRCm39) V8A probably benign Het
Rspry1 C A 8: 95,380,892 (GRCm39) R399S probably benign Het
Rufy4 T C 1: 74,186,822 (GRCm39) C537R probably damaging Het
Rxfp2 A G 5: 149,993,725 (GRCm39) T596A probably benign Het
Sap18b G A 8: 96,551,998 (GRCm39) A3T unknown Het
Serpina3j A G 12: 104,280,986 (GRCm39) D53G probably damaging Het
Skint3 T A 4: 112,155,386 (GRCm39) D381E possibly damaging Het
Slirp T C 12: 87,496,192 (GRCm39) S96P possibly damaging Het
Snx6 T C 12: 54,817,513 (GRCm39) E128G probably damaging Het
Stap1 A G 5: 86,238,787 (GRCm39) T152A possibly damaging Het
Tcf20 A T 15: 82,736,158 (GRCm39) N1764K probably damaging Het
Thap2 A T 10: 115,208,744 (GRCm39) Y125* probably null Het
Tnrc18 G A 5: 142,725,911 (GRCm39) R1793C unknown Het
Trpm3 C T 19: 22,903,548 (GRCm39) R945* probably null Het
Ugt1a10 T A 1: 87,983,632 (GRCm39) D143E probably damaging Het
Ush2a C T 1: 188,487,403 (GRCm39) T3057M probably benign Het
Zc3h6 A T 2: 128,844,076 (GRCm39) I207F possibly damaging Het
Zfp518a T C 19: 40,901,954 (GRCm39) S628P probably benign Het
Zup1 T C 10: 33,803,462 (GRCm39) N541D possibly damaging Het
Other mutations in Ticrr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Ticrr APN 7 79,327,031 (GRCm39) missense probably damaging 1.00
IGL00596:Ticrr APN 7 79,327,041 (GRCm39) missense probably damaging 1.00
IGL01327:Ticrr APN 7 79,344,209 (GRCm39) missense probably benign 0.00
IGL01525:Ticrr APN 7 79,332,197 (GRCm39) missense probably damaging 1.00
IGL01565:Ticrr APN 7 79,344,296 (GRCm39) missense probably benign
IGL01936:Ticrr APN 7 79,344,297 (GRCm39) missense probably benign 0.11
IGL02160:Ticrr APN 7 79,343,767 (GRCm39) missense probably benign 0.29
IGL02246:Ticrr APN 7 79,325,076 (GRCm39) missense probably damaging 1.00
IGL02487:Ticrr APN 7 79,332,769 (GRCm39) missense possibly damaging 0.86
IGL02593:Ticrr APN 7 79,345,214 (GRCm39) missense probably damaging 0.99
IGL02970:Ticrr APN 7 79,344,919 (GRCm39) missense probably benign 0.01
FR4304:Ticrr UTSW 7 79,344,059 (GRCm39) intron probably benign
PIT4305001:Ticrr UTSW 7 79,328,771 (GRCm39) missense possibly damaging 0.95
PIT4791001:Ticrr UTSW 7 79,319,386 (GRCm39) missense possibly damaging 0.92
R0016:Ticrr UTSW 7 79,343,540 (GRCm39) missense probably benign 0.01
R0062:Ticrr UTSW 7 79,317,654 (GRCm39) missense probably benign 0.01
R0062:Ticrr UTSW 7 79,317,654 (GRCm39) missense probably benign 0.01
R0067:Ticrr UTSW 7 79,327,158 (GRCm39) missense probably damaging 1.00
R0067:Ticrr UTSW 7 79,327,158 (GRCm39) missense probably damaging 1.00
R0362:Ticrr UTSW 7 79,327,088 (GRCm39) missense probably damaging 1.00
R0482:Ticrr UTSW 7 79,344,236 (GRCm39) missense probably damaging 0.99
R0595:Ticrr UTSW 7 79,345,311 (GRCm39) missense possibly damaging 0.94
R1118:Ticrr UTSW 7 79,343,701 (GRCm39) missense probably benign 0.23
R1119:Ticrr UTSW 7 79,343,701 (GRCm39) missense probably benign 0.23
R1572:Ticrr UTSW 7 79,331,572 (GRCm39) missense probably damaging 1.00
R1658:Ticrr UTSW 7 79,345,297 (GRCm39) missense possibly damaging 0.57
R1757:Ticrr UTSW 7 79,328,794 (GRCm39) nonsense probably null
R1757:Ticrr UTSW 7 79,325,071 (GRCm39) missense probably damaging 0.99
R1862:Ticrr UTSW 7 79,344,955 (GRCm39) missense probably damaging 1.00
R1869:Ticrr UTSW 7 79,328,883 (GRCm39) missense probably damaging 1.00
R1938:Ticrr UTSW 7 79,325,142 (GRCm39) missense probably damaging 0.98
R1966:Ticrr UTSW 7 79,344,483 (GRCm39) nonsense probably null
R2006:Ticrr UTSW 7 79,343,821 (GRCm39) missense possibly damaging 0.93
R2178:Ticrr UTSW 7 79,315,433 (GRCm39) missense probably benign 0.12
R3404:Ticrr UTSW 7 79,344,539 (GRCm39) missense probably benign 0.06
R3405:Ticrr UTSW 7 79,344,539 (GRCm39) missense probably benign 0.06
R3941:Ticrr UTSW 7 79,343,445 (GRCm39) intron probably benign
R3950:Ticrr UTSW 7 79,331,817 (GRCm39) missense probably damaging 1.00
R3951:Ticrr UTSW 7 79,331,817 (GRCm39) missense probably damaging 1.00
R3952:Ticrr UTSW 7 79,331,817 (GRCm39) missense probably damaging 1.00
R4967:Ticrr UTSW 7 79,310,158 (GRCm39) missense probably damaging 0.99
R4972:Ticrr UTSW 7 79,319,416 (GRCm39) missense probably damaging 0.98
R5259:Ticrr UTSW 7 79,344,471 (GRCm39) missense probably benign 0.01
R5272:Ticrr UTSW 7 79,319,353 (GRCm39) missense probably benign 0.44
R5480:Ticrr UTSW 7 79,310,557 (GRCm39) missense probably damaging 1.00
R5568:Ticrr UTSW 7 79,345,044 (GRCm39) nonsense probably null
R5568:Ticrr UTSW 7 79,339,715 (GRCm39) critical splice donor site probably null
R5588:Ticrr UTSW 7 79,328,853 (GRCm39) missense probably damaging 1.00
R5698:Ticrr UTSW 7 79,328,881 (GRCm39) missense probably benign
R5879:Ticrr UTSW 7 79,346,438 (GRCm39) missense probably benign 0.12
R5980:Ticrr UTSW 7 79,310,703 (GRCm39) missense probably damaging 0.99
R6128:Ticrr UTSW 7 79,343,716 (GRCm39) missense probably damaging 1.00
R6277:Ticrr UTSW 7 79,344,444 (GRCm39) missense probably benign 0.00
R6335:Ticrr UTSW 7 79,344,031 (GRCm39) splice site probably null
R6866:Ticrr UTSW 7 79,343,705 (GRCm39) missense possibly damaging 0.47
R6905:Ticrr UTSW 7 79,315,598 (GRCm39) missense probably benign 0.00
R6923:Ticrr UTSW 7 79,341,601 (GRCm39) missense probably damaging 0.98
R6962:Ticrr UTSW 7 79,315,645 (GRCm39) missense possibly damaging 0.84
R7232:Ticrr UTSW 7 79,343,490 (GRCm39) missense probably damaging 0.96
R7285:Ticrr UTSW 7 79,310,610 (GRCm39) missense possibly damaging 0.93
R7385:Ticrr UTSW 7 79,341,597 (GRCm39) missense possibly damaging 0.93
R7426:Ticrr UTSW 7 79,343,734 (GRCm39) missense probably benign
R7583:Ticrr UTSW 7 79,346,487 (GRCm39) nonsense probably null
R7749:Ticrr UTSW 7 79,328,844 (GRCm39) missense possibly damaging 0.94
R7863:Ticrr UTSW 7 79,331,760 (GRCm39) missense possibly damaging 0.92
R7899:Ticrr UTSW 7 79,319,233 (GRCm39) missense probably benign 0.23
R7935:Ticrr UTSW 7 79,331,584 (GRCm39) missense probably damaging 0.99
R8005:Ticrr UTSW 7 79,343,796 (GRCm39) missense probably damaging 0.98
R8080:Ticrr UTSW 7 79,334,012 (GRCm39) splice site probably null
R8181:Ticrr UTSW 7 79,310,728 (GRCm39) missense possibly damaging 0.92
R8349:Ticrr UTSW 7 79,344,428 (GRCm39) missense probably benign 0.27
R8410:Ticrr UTSW 7 79,317,423 (GRCm39) missense probably damaging 0.98
R8449:Ticrr UTSW 7 79,344,428 (GRCm39) missense probably benign 0.27
R9073:Ticrr UTSW 7 79,317,679 (GRCm39) missense probably benign 0.01
R9090:Ticrr UTSW 7 79,310,604 (GRCm39) missense possibly damaging 0.85
R9271:Ticrr UTSW 7 79,310,604 (GRCm39) missense possibly damaging 0.85
R9287:Ticrr UTSW 7 79,343,516 (GRCm39) missense possibly damaging 0.89
R9368:Ticrr UTSW 7 79,330,735 (GRCm39) missense probably damaging 0.99
R9469:Ticrr UTSW 7 79,344,511 (GRCm39) missense probably benign 0.03
R9502:Ticrr UTSW 7 79,343,597 (GRCm39) missense probably benign
R9614:Ticrr UTSW 7 79,345,754 (GRCm39) missense probably damaging 1.00
R9761:Ticrr UTSW 7 79,345,313 (GRCm39) missense probably damaging 1.00
R9779:Ticrr UTSW 7 79,328,802 (GRCm39) missense probably benign 0.37
Predicted Primers PCR Primer
(F):5'- TTGTTCAGAAACACTTCAGATGCC -3'
(R):5'- ATAGGCCGAGGACTGTTACC -3'

Sequencing Primer
(F):5'- TCAGATGCCTCTTAAAGCCACTG -3'
(R):5'- GCCGAGGACTGTTACCTAGTATCAC -3'
Posted On 2016-09-06