Incidental Mutation 'R5374:Rspry1'
ID 428942
Institutional Source Beutler Lab
Gene Symbol Rspry1
Ensembl Gene ENSMUSG00000050079
Gene Name ring finger and SPRY domain containing 1
Synonyms 4930470D19Rik
MMRRC Submission 042950-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.505) question?
Stock # R5374 (G1)
Quality Score 225
Status Validated
Chromosome 8
Chromosomal Location 94601937-94660275 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 94654264 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Serine at position 399 (R399S)
Ref Sequence ENSEMBL: ENSMUSP00000148724 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060389] [ENSMUST00000211983] [ENSMUST00000212729]
AlphaFold Q8BVR6
Predicted Effect probably benign
Transcript: ENSMUST00000060389
AA Change: R523S

PolyPhen 2 Score 0.385 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000057275
Gene: ENSMUSG00000050079
AA Change: R523S

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
low complexity region 30 39 N/A INTRINSIC
low complexity region 74 95 N/A INTRINSIC
SPRY 358 482 2.94e-26 SMART
RING 527 561 3.93e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211941
Predicted Effect probably benign
Transcript: ENSMUST00000211983
AA Change: R523S

PolyPhen 2 Score 0.385 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000212729
AA Change: R399S

PolyPhen 2 Score 0.385 (Sensitivity: 0.90; Specificity: 0.89)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 96% (81/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a glycoprotein that contains a RING-type zinc finger domain and an SPRY domain of unknown function. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Feb 2015]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,067,635 S862G probably benign Het
2410089E03Rik T C 15: 8,270,803 V3198A unknown Het
Adgrf1 G A 17: 43,291,005 probably benign Het
Adss T G 1: 177,796,388 I3L probably benign Het
Anapc7 T A 5: 122,438,217 D302E probably benign Het
Ank3 A G 10: 69,953,476 probably null Het
Astn2 A C 4: 65,397,005 V1145G probably damaging Het
Babam2 C T 5: 32,007,230 probably benign Het
Blvrb A G 7: 27,465,846 H238R possibly damaging Het
Cacna1b C T 2: 24,706,216 V488I probably damaging Het
Ccdc88a C T 11: 29,463,409 T649M possibly damaging Het
Cdh12 A C 15: 21,583,912 S613R probably damaging Het
Cisd2 A G 3: 135,408,835 V125A probably benign Het
Clcn2 C A 16: 20,709,669 G478W possibly damaging Het
Cntnap2 T A 6: 47,107,969 H1121Q probably benign Het
Corin A T 5: 72,304,953 C876S probably damaging Het
Cox7c T C 13: 86,046,620 Y19C probably benign Het
Cspp1 T G 1: 10,134,126 L1038R probably damaging Het
Cwc15 A G 9: 14,504,938 K147E possibly damaging Het
Dlgap2 A G 8: 14,823,614 D739G probably benign Het
Dmxl2 A G 9: 54,369,189 probably benign Het
Dock5 A G 14: 67,805,756 V864A possibly damaging Het
Dock7 A G 4: 98,989,038 F1088L possibly damaging Het
Dpysl3 T C 18: 43,361,036 Y193C probably damaging Het
Dtna T C 18: 23,651,613 Y730H probably damaging Het
Dusp3 A G 11: 101,984,625 Y38H possibly damaging Het
Eif3m A T 2: 105,012,932 I151N probably damaging Het
Entpd2 C T 2: 25,399,726 T380I probably damaging Het
Epb41l3 C A 17: 69,286,800 H810N probably damaging Het
Fcrl5 A G 3: 87,446,391 T348A probably benign Het
Ginm1 A G 10: 7,779,314 S55P probably damaging Het
Glt1d1 C A 5: 127,657,084 probably null Het
Gm15433 T A 1: 84,964,112 noncoding transcript Het
Gm8221 A G 15: 77,626,152 noncoding transcript Het
Gramd1c A G 16: 43,983,241 V603A probably benign Het
Grm1 A G 10: 11,080,442 S33P probably benign Het
Gstp3 T C 19: 4,057,922 N137S possibly damaging Het
Kdm5d C T Y: 927,995 P756S probably benign Het
Ly75 A T 2: 60,311,771 L1332M possibly damaging Het
Med1 T A 11: 98,163,963 K378N probably damaging Het
Mn1 A G 5: 111,421,886 probably null Het
Mpo T C 11: 87,803,611 probably null Het
Nom1 C G 5: 29,441,379 R555G probably damaging Het
Nsmce4a C T 7: 130,538,170 R276Q probably benign Het
Nt5c G A 11: 115,490,817 probably null Het
Olfr472 T C 7: 107,903,491 I258T possibly damaging Het
Olfr670 G T 7: 104,959,996 H245Q probably damaging Het
Olfr908 CACAACAACA CACAACA 9: 38,516,138 probably benign Het
Pcdhga4 T C 18: 37,685,596 V66A probably damaging Het
Pik3c3 T C 18: 30,312,561 S534P probably benign Het
Pla2g4e A T 2: 120,186,395 C222S probably benign Het
Plch1 A C 3: 63,698,078 H1468Q probably benign Het
Psd2 T A 18: 36,007,503 W610R probably damaging Het
Ptgs1 A T 2: 36,251,186 K548N probably damaging Het
Ptprz1 T A 6: 23,007,355 V1639E probably damaging Het
Rangap1 A T 15: 81,706,494 S466T probably benign Het
Rgsl1 C T 1: 153,790,307 V986I probably benign Het
Rhobtb3 T C 13: 75,878,895 Y453C probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Rxfp2 A G 5: 150,070,260 T596A probably benign Het
Sap18b G A 8: 95,825,370 A3T unknown Het
Serpina3j A G 12: 104,314,727 D53G probably damaging Het
Skint3 T A 4: 112,298,189 D381E possibly damaging Het
Slirp T C 12: 87,449,422 S96P possibly damaging Het
Snx6 T C 12: 54,770,728 E128G probably damaging Het
Stap1 A G 5: 86,090,928 T152A possibly damaging Het
Tcf20 A T 15: 82,851,957 N1764K probably damaging Het
Thap2 A T 10: 115,372,839 Y125* probably null Het
Ticrr T G 7: 79,690,942 Y1031* probably null Het
Tnrc18 G A 5: 142,740,156 R1793C unknown Het
Trpm3 C T 19: 22,926,184 R945* probably null Het
Ugt1a10 T A 1: 88,055,910 D143E probably damaging Het
Ush2a C T 1: 188,755,206 T3057M probably benign Het
Zc3h6 A T 2: 129,002,156 I207F possibly damaging Het
Zfp518a T C 19: 40,913,510 S628P probably benign Het
Zufsp T C 10: 33,927,466 N541D possibly damaging Het
Other mutations in Rspry1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Rspry1 APN 8 94622986 start codon destroyed probably null 0.89
IGL00158:Rspry1 APN 8 94622980 intron probably benign
IGL01141:Rspry1 APN 8 94649855 missense probably benign 0.00
IGL01860:Rspry1 APN 8 94649816 missense probably benign 0.00
IGL02174:Rspry1 APN 8 94633140 missense possibly damaging 0.84
IGL02819:Rspry1 APN 8 94654256 missense probably benign 0.42
IGL02926:Rspry1 APN 8 94649811 missense probably damaging 1.00
IGL03366:Rspry1 APN 8 94650334 missense probably benign 0.00
R0570:Rspry1 UTSW 8 94629792 missense probably damaging 1.00
R1833:Rspry1 UTSW 8 94635488 missense probably damaging 1.00
R1988:Rspry1 UTSW 8 94632054 critical splice acceptor site probably null
R2444:Rspry1 UTSW 8 94623107 missense probably damaging 1.00
R3623:Rspry1 UTSW 8 94649777 missense probably damaging 1.00
R3624:Rspry1 UTSW 8 94649777 missense probably damaging 1.00
R4275:Rspry1 UTSW 8 94649761 missense probably benign 0.00
R4888:Rspry1 UTSW 8 94658789 missense probably benign 0.19
R5026:Rspry1 UTSW 8 94650303 missense probably damaging 1.00
R5310:Rspry1 UTSW 8 94623185 missense probably benign
R5374:Rspry1 UTSW 8 94623008 missense probably benign 0.00
R5387:Rspry1 UTSW 8 94638286 missense possibly damaging 0.95
R5517:Rspry1 UTSW 8 94636760 splice site probably null
R5631:Rspry1 UTSW 8 94629078 start codon destroyed possibly damaging 0.79
R5653:Rspry1 UTSW 8 94636611 splice site probably null
R6065:Rspry1 UTSW 8 94622987 start codon destroyed probably null 0.98
R6220:Rspry1 UTSW 8 94658750 missense probably damaging 1.00
R6276:Rspry1 UTSW 8 94623258 missense probably damaging 1.00
R6821:Rspry1 UTSW 8 94635431 nonsense probably null
R7390:Rspry1 UTSW 8 94623185 missense probably benign
R7460:Rspry1 UTSW 8 94650335 missense probably benign 0.00
R7644:Rspry1 UTSW 8 94658768 missense probably benign 0.00
R7717:Rspry1 UTSW 8 94623122 missense probably damaging 1.00
R7768:Rspry1 UTSW 8 94629841 missense probably damaging 1.00
R7940:Rspry1 UTSW 8 94623007 missense probably benign 0.22
R7978:Rspry1 UTSW 8 94623125 missense probably damaging 0.98
R8087:Rspry1 UTSW 8 94654297 missense probably benign 0.04
R8174:Rspry1 UTSW 8 94649822 missense probably damaging 0.97
R8326:Rspry1 UTSW 8 94639589 missense probably damaging 1.00
R8676:Rspry1 UTSW 8 94632119 missense probably benign 0.01
R8715:Rspry1 UTSW 8 94623260 missense probably damaging 0.98
R8869:Rspry1 UTSW 8 94633152 missense probably damaging 0.97
R9253:Rspry1 UTSW 8 94622993 missense probably damaging 1.00
R9281:Rspry1 UTSW 8 94636631 missense probably damaging 1.00
R9699:Rspry1 UTSW 8 94654229 missense probably benign 0.01
X0010:Rspry1 UTSW 8 94629801 missense possibly damaging 0.76
Predicted Primers PCR Primer
(F):5'- CACTCTGCTGAAGCTGAAATG -3'
(R):5'- TGGAAAGCAACAGATACTACCTGG -3'

Sequencing Primer
(F):5'- CTGCTGAAGCTGAAATGTATGAAAC -3'
(R):5'- CAGATACTACCTGGCAACTTAATTC -3'
Posted On 2016-09-06