Mutagenetix > Incidental Mutations

Incidental Mutation 'R5374:Med1'

428954

Institutional Source

Beutler Lab

Gene Symbol

Med1

Ensembl Gene

ENSMUSG00000018160

Gene Name

mediator complex subunit 1

Synonyms

Pparbp, l11Jus15, PBP, TRAP 220, CRSP210, DRIP205, TRAP220

MMRRC Submission

042950-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5374 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

98152154-98193293 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 98163963 bp

Zygosity

Heterozygous

Amino Acid Change

Lysine to Asparagine at position 378 (K378N)

Ref Sequence

ENSEMBL: ENSMUSP00000090411 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000018304] [ENSMUST00000092735] [ENSMUST00000107545]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000018304
AA Change: K363N

PolyPhen 2 Score 0.870 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000018304
Gene: ENSMUSG00000018160
AA Change: K363N

Domain	Start	End	E-Value	Type
Pfam:Med1	18	414	3.7e-112	PFAM
low complexity region	536	559	N/A	INTRINSIC
low complexity region	595	619	N/A	INTRINSIC
low complexity region	667	678	N/A	INTRINSIC
low complexity region	960	981	N/A	INTRINSIC
low complexity region	989	999	N/A	INTRINSIC
low complexity region	1015	1036	N/A	INTRINSIC
low complexity region	1042	1054	N/A	INTRINSIC
low complexity region	1063	1138	N/A	INTRINSIC
low complexity region	1170	1183	N/A	INTRINSIC
low complexity region	1205	1243	N/A	INTRINSIC
low complexity region	1250	1281	N/A	INTRINSIC
low complexity region	1344	1364	N/A	INTRINSIC
low complexity region	1482	1503	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000092735
AA Change: K378N

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000090411
Gene: ENSMUSG00000018160
AA Change: K378N

Domain	Start	End	E-Value	Type
Pfam:Med1	33	429	1.2e-113	PFAM
transmembrane domain	585	607	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000107545
AA Change: K378N

PolyPhen 2 Score 0.870 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000103169
Gene: ENSMUSG00000018160
AA Change: K378N

Domain	Start	End	E-Value	Type
Pfam:Med1	59	426	2.9e-74	PFAM
low complexity region	551	574	N/A	INTRINSIC
low complexity region	610	634	N/A	INTRINSIC
low complexity region	682	693	N/A	INTRINSIC
low complexity region	975	996	N/A	INTRINSIC
low complexity region	1004	1014	N/A	INTRINSIC
low complexity region	1030	1051	N/A	INTRINSIC
low complexity region	1057	1069	N/A	INTRINSIC
low complexity region	1078	1153	N/A	INTRINSIC
low complexity region	1185	1198	N/A	INTRINSIC
low complexity region	1220	1258	N/A	INTRINSIC
low complexity region	1265	1296	N/A	INTRINSIC
low complexity region	1359	1379	N/A	INTRINSIC
low complexity region	1497	1518	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126483

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147933

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.2%
20x: 95.2%

Validation Efficiency

96% (81/84)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The activation of gene transcription is a multistep process that is triggered by factors that recognize transcriptional enhancer sites in DNA. These factors work with co-activators to direct transcriptional initiation by the RNA polymerase II apparatus. The protein encoded by this gene is a subunit of the CRSP (cofactor required for SP1 activation) complex, which, along with TFIID, is required for efficient activation by SP1. This protein is also a component of other multisubunit complexes e.g. thyroid hormone receptor-(TR-) associated proteins which interact with TR and facilitate TR function on DNA templates in conjunction with initiation factors and cofactors. It also regulates p53-dependent apoptosis and it is essential for adipogenesis. This protein is known to have the ability to self-oligomerize. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations have defects of placental vasculature, heart, and lens, arrested erythrocytic differentiation, impaired neuronal development, and die by embryonic day 11.5. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110002E22Rik	A	G	3: 138,067,635	S862G	probably benign	Het
2410089E03Rik	T	C	15: 8,270,803	V3198A	unknown	Het
Adgrf1	G	A	17: 43,291,005		probably benign	Het
Adss	T	G	1: 177,796,388	I3L	probably benign	Het
Anapc7	T	A	5: 122,438,217	D302E	probably benign	Het
Ank3	A	G	10: 69,953,476		probably null	Het
Astn2	A	C	4: 65,397,005	V1145G	probably damaging	Het
Babam2	C	T	5: 32,007,230		probably benign	Het
Blvrb	A	G	7: 27,465,846	H238R	possibly damaging	Het
Cacna1b	C	T	2: 24,706,216	V488I	probably damaging	Het
Ccdc88a	C	T	11: 29,463,409	T649M	possibly damaging	Het
Cdh12	A	C	15: 21,583,912	S613R	probably damaging	Het
Cisd2	A	G	3: 135,408,835	V125A	probably benign	Het
Clcn2	C	A	16: 20,709,669	G478W	possibly damaging	Het
Cntnap2	T	A	6: 47,107,969	H1121Q	probably benign	Het
Corin	A	T	5: 72,304,953	C876S	probably damaging	Het
Cox7c	T	C	13: 86,046,620	Y19C	probably benign	Het
Cspp1	T	G	1: 10,134,126	L1038R	probably damaging	Het
Cwc15	A	G	9: 14,504,938	K147E	possibly damaging	Het
Dlgap2	A	G	8: 14,823,614	D739G	probably benign	Het
Dmxl2	A	G	9: 54,369,189		probably benign	Het
Dock5	A	G	14: 67,805,756	V864A	possibly damaging	Het
Dock7	A	G	4: 98,989,038	F1088L	possibly damaging	Het
Dpysl3	T	C	18: 43,361,036	Y193C	probably damaging	Het
Dtna	T	C	18: 23,651,613	Y730H	probably damaging	Het
Dusp3	A	G	11: 101,984,625	Y38H	possibly damaging	Het
Eif3m	A	T	2: 105,012,932	I151N	probably damaging	Het
Entpd2	C	T	2: 25,399,726	T380I	probably damaging	Het
Epb41l3	C	A	17: 69,286,800	H810N	probably damaging	Het
Fcrl5	A	G	3: 87,446,391	T348A	probably benign	Het
Ginm1	A	G	10: 7,779,314	S55P	probably damaging	Het
Glt1d1	C	A	5: 127,657,084		probably null	Het
Gm15433	T	A	1: 84,964,112		noncoding transcript	Het
Gm8221	A	G	15: 77,626,152		noncoding transcript	Het
Gramd1c	A	G	16: 43,983,241	V603A	probably benign	Het
Grm1	A	G	10: 11,080,442	S33P	probably benign	Het
Gstp3	T	C	19: 4,057,922	N137S	possibly damaging	Het
Kdm5d	C	T	Y: 927,995	P756S	probably benign	Het
Ly75	A	T	2: 60,311,771	L1332M	possibly damaging	Het
Mn1	A	G	5: 111,421,886		probably null	Het
Mpo	T	C	11: 87,803,611		probably null	Het
Nom1	C	G	5: 29,441,379	R555G	probably damaging	Het
Nsmce4a	C	T	7: 130,538,170	R276Q	probably benign	Het
Nt5c	G	A	11: 115,490,817		probably null	Het
Olfr472	T	C	7: 107,903,491	I258T	possibly damaging	Het
Olfr670	G	T	7: 104,959,996	H245Q	probably damaging	Het
Olfr908	CACAACAACA	CACAACA	9: 38,516,138		probably benign	Het
Pcdhga4	T	C	18: 37,685,596	V66A	probably damaging	Het
Pik3c3	T	C	18: 30,312,561	S534P	probably benign	Het
Pla2g4e	A	T	2: 120,186,395	C222S	probably benign	Het
Plch1	A	C	3: 63,698,078	H1468Q	probably benign	Het
Psd2	T	A	18: 36,007,503	W610R	probably damaging	Het
Ptgs1	A	T	2: 36,251,186	K548N	probably damaging	Het
Ptprz1	T	A	6: 23,007,355	V1639E	probably damaging	Het
Rangap1	A	T	15: 81,706,494	S466T	probably benign	Het
Rgsl1	C	T	1: 153,790,307	V986I	probably benign	Het
Rhobtb3	T	C	13: 75,878,895	Y453C	probably damaging	Het
Rspry1	T	C	8: 94,623,008	V8A	probably benign	Het
Rspry1	C	A	8: 94,654,264	R399S	probably benign	Het
Rufy4	T	C	1: 74,147,663	C537R	probably damaging	Het
Rxfp2	A	G	5: 150,070,260	T596A	probably benign	Het
Sap18b	G	A	8: 95,825,370	A3T	unknown	Het
Serpina3j	A	G	12: 104,314,727	D53G	probably damaging	Het
Skint3	T	A	4: 112,298,189	D381E	possibly damaging	Het
Slirp	T	C	12: 87,449,422	S96P	possibly damaging	Het
Snx6	T	C	12: 54,770,728	E128G	probably damaging	Het
Stap1	A	G	5: 86,090,928	T152A	possibly damaging	Het
Tcf20	A	T	15: 82,851,957	N1764K	probably damaging	Het
Thap2	A	T	10: 115,372,839	Y125*	probably null	Het
Ticrr	T	G	7: 79,690,942	Y1031*	probably null	Het
Tnrc18	G	A	5: 142,740,156	R1793C	unknown	Het
Trpm3	C	T	19: 22,926,184	R945*	probably null	Het
Ugt1a10	T	A	1: 88,055,910	D143E	probably damaging	Het
Ush2a	C	T	1: 188,755,206	T3057M	probably benign	Het
Zc3h6	A	T	2: 129,002,156	I207F	possibly damaging	Het
Zfp518a	T	C	19: 40,913,510	S628P	probably benign	Het
Zufsp	T	C	10: 33,927,466	N541D	possibly damaging	Het

Other mutations in Med1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00556:Med1	APN	11	98155684	intron	probably benign
IGL00690:Med1	APN	11	98169400	missense	possibly damaging	0.94
IGL01087:Med1	APN	11	98180285	missense	probably damaging	1.00
IGL01133:Med1	APN	11	98157986	nonsense	probably null
IGL02223:Med1	APN	11	98157876	missense	probably damaging	1.00
IGL02257:Med1	APN	11	98180270	missense	probably damaging	0.98
IGL02699:Med1	APN	11	98180025	missense	possibly damaging	0.61
IGL02706:Med1	APN	11	98156707	intron	probably benign
IGL02902:Med1	APN	11	98156509	intron	probably benign
IGL02986:Med1	APN	11	98156260	intron	probably benign
IGL03011:Med1	APN	11	98161033	missense	possibly damaging	0.92
IGL03282:Med1	APN	11	98156817	missense	probably damaging	1.00
IGL03303:Med1	APN	11	98158352	missense	probably damaging	1.00
IGL03342:Med1	APN	11	98189180	critical splice donor site	probably null
IGL03410:Med1	APN	11	98189183	missense	possibly damaging	0.62
PIT4453001:Med1	UTSW	11	98158417	missense	probably benign	0.40
R0040:Med1	UTSW	11	98166255	critical splice donor site	probably null
R0206:Med1	UTSW	11	98155689	intron	probably benign
R0206:Med1	UTSW	11	98155689	intron	probably benign
R0208:Med1	UTSW	11	98155689	intron	probably benign
R0310:Med1	UTSW	11	98167574	missense	probably benign	0.38
R0505:Med1	UTSW	11	98156904	missense	probably damaging	1.00
R0597:Med1	UTSW	11	98169438	missense	probably benign	0.08
R0680:Med1	UTSW	11	98180166	intron	probably null
R0686:Med1	UTSW	11	98158404	missense	probably damaging	1.00
R0698:Med1	UTSW	11	98155689	intron	probably benign
R1293:Med1	UTSW	11	98157036	missense	possibly damaging	0.93
R1302:Med1	UTSW	11	98157449	missense	possibly damaging	0.50
R1365:Med1	UTSW	11	98155995	intron	probably benign
R1537:Med1	UTSW	11	98160946	missense	probably damaging	0.97
R1609:Med1	UTSW	11	98161170	missense	possibly damaging	0.91
R1631:Med1	UTSW	11	98155626	intron	probably benign
R1792:Med1	UTSW	11	98157283	missense	probably damaging	1.00
R1831:Med1	UTSW	11	98156611	intron	probably benign
R1837:Med1	UTSW	11	98169412	missense	probably damaging	1.00
R2366:Med1	UTSW	11	98161182	missense	probably damaging	0.98
R3754:Med1	UTSW	11	98166722	missense	possibly damaging	0.77
R3762:Med1	UTSW	11	98155515	intron	probably benign
R4012:Med1	UTSW	11	98171706	missense	possibly damaging	0.85
R4112:Med1	UTSW	11	98180087	missense	probably damaging	1.00
R4384:Med1	UTSW	11	98152862	unclassified	probably benign
R4579:Med1	UTSW	11	98158422	missense	possibly damaging	0.56
R4740:Med1	UTSW	11	98180264	nonsense	probably null
R4819:Med1	UTSW	11	98155432	intron	probably benign
R4879:Med1	UTSW	11	98155360	unclassified	probably benign
R4993:Med1	UTSW	11	98163904	missense	probably damaging	1.00
R5040:Med1	UTSW	11	98155404	intron	probably benign
R5249:Med1	UTSW	11	98157240	missense	probably benign	0.43
R5373:Med1	UTSW	11	98163963	missense	probably damaging	0.99
R5552:Med1	UTSW	11	98166331	nonsense	probably null
R5692:Med1	UTSW	11	98156380	intron	probably benign
R6010:Med1	UTSW	11	98158362	missense	probably damaging	1.00
R6149:Med1	UTSW	11	98183853	missense	possibly damaging	0.74
R6417:Med1	UTSW	11	98157228	missense	probably damaging	0.97
R7301:Med1	UTSW	11	98152808	missense	probably benign	0.23
R7507:Med1	UTSW	11	98158026	missense	probably damaging	1.00
R7529:Med1	UTSW	11	98155965	missense	unknown
R7588:Med1	UTSW	11	98155572	missense	unknown
R7654:Med1	UTSW	11	98169363	missense	possibly damaging	0.75
R7662:Med1	UTSW	11	98155392	missense	unknown
R7679:Med1	UTSW	11	98156061	missense	unknown

Predicted Primers

PCR Primer
(F):5'- CTAAAGCCATCTGGGTGTTGTTTC -3'
(R):5'- GAGGTCTGTATAGCTAGGTAACG -3'

Sequencing Primer
(F):5'- CATCTCCCAGTAAGTTGATCAGAAGG -3'
(R):5'- GGTCTGTATAGCTAGGTAACGTTTAC -3'

Posted On

2016-09-06