Incidental Mutation 'R5374:Dusp3'
ID428955
Institutional Source Beutler Lab
Gene Symbol Dusp3
Ensembl Gene ENSMUSG00000003518
Gene Namedual specificity phosphatase 3 (vaccinia virus phosphatase VH1-related)
SynonymsT-DSP11, 5031436O03Rik, 2210015O03Rik, VHR
MMRRC Submission 042950-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5374 (G1)
Quality Score212
Status Validated
Chromosome11
Chromosomal Location101971143-101987013 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 101984625 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 38 (Y38H)
Ref Sequence ENSEMBL: ENSMUSP00000135443 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003612] [ENSMUST00000010985] [ENSMUST00000107172] [ENSMUST00000107173] [ENSMUST00000143177] [ENSMUST00000151678] [ENSMUST00000175972] [ENSMUST00000176261] [ENSMUST00000176722]
Predicted Effect probably benign
Transcript: ENSMUST00000003612
AA Change: Y38H

PolyPhen 2 Score 0.432 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000003612
Gene: ENSMUSG00000003518
AA Change: Y38H

DomainStartEndE-ValueType
DSPc 29 176 8.04e-58 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000010985
SMART Domains Protein: ENSMUSP00000010985
Gene: ENSMUSG00000010841

DomainStartEndE-ValueType
Pfam:KIAA1430 35 130 1.1e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107172
AA Change: Y38H

PolyPhen 2 Score 0.432 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000102790
Gene: ENSMUSG00000003518
AA Change: Y38H

DomainStartEndE-ValueType
DSPc 29 176 8.04e-58 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107173
AA Change: Y63H

PolyPhen 2 Score 0.442 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000102791
Gene: ENSMUSG00000003518
AA Change: Y63H

DomainStartEndE-ValueType
DSPc 54 201 8.04e-58 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125794
Predicted Effect probably benign
Transcript: ENSMUST00000143177
AA Change: Y38H

PolyPhen 2 Score 0.216 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000135821
Gene: ENSMUSG00000003518
AA Change: Y38H

DomainStartEndE-ValueType
PDB:1J4X|A 2 55 1e-22 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000151678
SMART Domains Protein: ENSMUSP00000135384
Gene: ENSMUSG00000003518

DomainStartEndE-ValueType
DSPc 3 108 6.99e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000175972
Predicted Effect possibly damaging
Transcript: ENSMUST00000176261
AA Change: Y38H

PolyPhen 2 Score 0.685 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000135443
Gene: ENSMUSG00000003518
AA Change: Y38H

DomainStartEndE-ValueType
Pfam:DSPc 37 126 1.5e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176722
SMART Domains Protein: ENSMUSP00000134890
Gene: ENSMUSG00000010841

DomainStartEndE-ValueType
Pfam:KIAA1430 1 80 4.8e-22 PFAM
Meta Mutation Damage Score 0.3461 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 96% (81/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mitogen-activated protein (MAP) kinase superfamily (MAPK/ERK, SAPK/JNK, p38), which are associated with cellular proliferation and differentiation. Different members of the family of dual specificity phosphatases show distinct substrate specificities for various MAP kinases, different tissue distribution and subcellular localization, and different modes of inducibility of their expression by extracellular stimuli. This gene maps in a region that contains the BRCA1 locus which confers susceptibility to breast and ovarian cancer. Although DUSP3 is expressed in both breast and ovarian tissues, mutation screening in breast cancer pedigrees and in sporadic tumors was negative, leading to the conclusion that this gene is not BRCA1. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased hemoglobin content and angiogenesis in Matrigel plugs and aortic explants. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,067,635 S862G probably benign Het
2410089E03Rik T C 15: 8,270,803 V3198A unknown Het
Adgrf1 G A 17: 43,291,005 probably benign Het
Adss T G 1: 177,796,388 I3L probably benign Het
Anapc7 T A 5: 122,438,217 D302E probably benign Het
Ank3 A G 10: 69,953,476 probably null Het
Astn2 A C 4: 65,397,005 V1145G probably damaging Het
Babam2 C T 5: 32,007,230 probably benign Het
Blvrb A G 7: 27,465,846 H238R possibly damaging Het
Cacna1b C T 2: 24,706,216 V488I probably damaging Het
Ccdc88a C T 11: 29,463,409 T649M possibly damaging Het
Cdh12 A C 15: 21,583,912 S613R probably damaging Het
Cisd2 A G 3: 135,408,835 V125A probably benign Het
Clcn2 C A 16: 20,709,669 G478W possibly damaging Het
Cntnap2 T A 6: 47,107,969 H1121Q probably benign Het
Corin A T 5: 72,304,953 C876S probably damaging Het
Cox7c T C 13: 86,046,620 Y19C probably benign Het
Cspp1 T G 1: 10,134,126 L1038R probably damaging Het
Cwc15 A G 9: 14,504,938 K147E possibly damaging Het
Dlgap2 A G 8: 14,823,614 D739G probably benign Het
Dmxl2 A G 9: 54,369,189 probably benign Het
Dock5 A G 14: 67,805,756 V864A possibly damaging Het
Dock7 A G 4: 98,989,038 F1088L possibly damaging Het
Dpysl3 T C 18: 43,361,036 Y193C probably damaging Het
Dtna T C 18: 23,651,613 Y730H probably damaging Het
Eif3m A T 2: 105,012,932 I151N probably damaging Het
Entpd2 C T 2: 25,399,726 T380I probably damaging Het
Epb41l3 C A 17: 69,286,800 H810N probably damaging Het
Fcrl5 A G 3: 87,446,391 T348A probably benign Het
Ginm1 A G 10: 7,779,314 S55P probably damaging Het
Glt1d1 C A 5: 127,657,084 probably null Het
Gm15433 T A 1: 84,964,112 noncoding transcript Het
Gm8221 A G 15: 77,626,152 noncoding transcript Het
Gramd1c A G 16: 43,983,241 V603A probably benign Het
Grm1 A G 10: 11,080,442 S33P probably benign Het
Gstp3 T C 19: 4,057,922 N137S possibly damaging Het
Kdm5d C T Y: 927,995 P756S probably benign Het
Ly75 A T 2: 60,311,771 L1332M possibly damaging Het
Med1 T A 11: 98,163,963 K378N probably damaging Het
Mn1 A G 5: 111,421,886 probably null Het
Mpo T C 11: 87,803,611 probably null Het
Nom1 C G 5: 29,441,379 R555G probably damaging Het
Nsmce4a C T 7: 130,538,170 R276Q probably benign Het
Nt5c G A 11: 115,490,817 probably null Het
Olfr472 T C 7: 107,903,491 I258T possibly damaging Het
Olfr670 G T 7: 104,959,996 H245Q probably damaging Het
Olfr908 CACAACAACA CACAACA 9: 38,516,138 probably benign Het
Pcdhga4 T C 18: 37,685,596 V66A probably damaging Het
Pik3c3 T C 18: 30,312,561 S534P probably benign Het
Pla2g4e A T 2: 120,186,395 C222S probably benign Het
Plch1 A C 3: 63,698,078 H1468Q probably benign Het
Psd2 T A 18: 36,007,503 W610R probably damaging Het
Ptgs1 A T 2: 36,251,186 K548N probably damaging Het
Ptprz1 T A 6: 23,007,355 V1639E probably damaging Het
Rangap1 A T 15: 81,706,494 S466T probably benign Het
Rgsl1 C T 1: 153,790,307 V986I probably benign Het
Rhobtb3 T C 13: 75,878,895 Y453C probably damaging Het
Rspry1 T C 8: 94,623,008 V8A probably benign Het
Rspry1 C A 8: 94,654,264 R399S probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Rxfp2 A G 5: 150,070,260 T596A probably benign Het
Sap18b G A 8: 95,825,370 A3T unknown Het
Serpina3j A G 12: 104,314,727 D53G probably damaging Het
Skint3 T A 4: 112,298,189 D381E possibly damaging Het
Slirp T C 12: 87,449,422 S96P possibly damaging Het
Snx6 T C 12: 54,770,728 E128G probably damaging Het
Stap1 A G 5: 86,090,928 T152A possibly damaging Het
Tcf20 A T 15: 82,851,957 N1764K probably damaging Het
Thap2 A T 10: 115,372,839 Y125* probably null Het
Ticrr T G 7: 79,690,942 Y1031* probably null Het
Tnrc18 G A 5: 142,740,156 R1793C unknown Het
Trpm3 C T 19: 22,926,184 R945* probably null Het
Ugt1a10 T A 1: 88,055,910 D143E probably damaging Het
Ush2a C T 1: 188,755,206 T3057M probably benign Het
Zc3h6 A T 2: 129,002,156 I207F possibly damaging Het
Zfp518a T C 19: 40,913,510 S628P probably benign Het
Zufsp T C 10: 33,927,466 N541D possibly damaging Het
Other mutations in Dusp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01020:Dusp3 APN 11 101984644 missense probably benign 0.37
R0189:Dusp3 UTSW 11 101981721 missense probably damaging 1.00
R0751:Dusp3 UTSW 11 101981728 missense probably benign 0.00
R1771:Dusp3 UTSW 11 101984735 start codon destroyed probably null 0.95
R2220:Dusp3 UTSW 11 101974805 missense probably damaging 1.00
R2762:Dusp3 UTSW 11 101974835 missense probably benign 0.00
R4591:Dusp3 UTSW 11 101973620 utr 3 prime probably benign
R5373:Dusp3 UTSW 11 101984625 missense possibly damaging 0.69
R6119:Dusp3 UTSW 11 101980669 unclassified probably benign
R6318:Dusp3 UTSW 11 101986871 missense probably benign 0.32
R6495:Dusp3 UTSW 11 101981827 missense probably benign 0.00
X0020:Dusp3 UTSW 11 101974778 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- AGAGAACGTGGTAGCCTTGAC -3'
(R):5'- CTTAGCCAGGGTGAATGAGTAC -3'

Sequencing Primer
(F):5'- CTTCATGCGCGGGGAGTAG -3'
(R):5'- ACGGGAGTGATGGCATCTC -3'
Posted On2016-09-06