Incidental Mutation 'R5374:Tcf20'
ID428968
Institutional Source Beutler Lab
Gene Symbol Tcf20
Ensembl Gene ENSMUSG00000041852
Gene Nametranscription factor 20
Synonymsstromelysin 1 PDGF responsive element binding protein, 2810438H08Rik, SPBP
MMRRC Submission 042950-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.724) question?
Stock #R5374 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location82808436-82987872 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 82851957 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 1764 (N1764K)
Ref Sequence ENSEMBL: ENSMUSP00000105136 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048966] [ENSMUST00000109510] [ENSMUST00000229547] [ENSMUST00000230403]
AlphaFold Q9EPQ8
Predicted Effect probably damaging
Transcript: ENSMUST00000048966
AA Change: N1764K

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000048486
Gene: ENSMUSG00000041852
AA Change: N1764K

DomainStartEndE-ValueType
low complexity region 42 74 N/A INTRINSIC
coiled coil region 163 203 N/A INTRINSIC
low complexity region 248 277 N/A INTRINSIC
low complexity region 322 354 N/A INTRINSIC
low complexity region 396 416 N/A INTRINSIC
low complexity region 443 456 N/A INTRINSIC
low complexity region 481 489 N/A INTRINSIC
low complexity region 511 523 N/A INTRINSIC
low complexity region 684 715 N/A INTRINSIC
low complexity region 1047 1056 N/A INTRINSIC
low complexity region 1532 1544 N/A INTRINSIC
low complexity region 1577 1593 N/A INTRINSIC
low complexity region 1602 1617 N/A INTRINSIC
low complexity region 1793 1804 N/A INTRINSIC
low complexity region 1860 1874 N/A INTRINSIC
PHD 1913 1960 6.7e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109510
AA Change: N1764K

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000105136
Gene: ENSMUSG00000041852
AA Change: N1764K

DomainStartEndE-ValueType
low complexity region 42 74 N/A INTRINSIC
coiled coil region 163 203 N/A INTRINSIC
low complexity region 248 277 N/A INTRINSIC
low complexity region 322 354 N/A INTRINSIC
low complexity region 396 416 N/A INTRINSIC
low complexity region 443 456 N/A INTRINSIC
low complexity region 481 489 N/A INTRINSIC
low complexity region 511 523 N/A INTRINSIC
low complexity region 684 715 N/A INTRINSIC
low complexity region 1047 1056 N/A INTRINSIC
low complexity region 1532 1544 N/A INTRINSIC
low complexity region 1577 1593 N/A INTRINSIC
low complexity region 1602 1617 N/A INTRINSIC
low complexity region 1793 1804 N/A INTRINSIC
low complexity region 1860 1874 N/A INTRINSIC
PHD 1913 1960 6.7e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000229547
Predicted Effect probably benign
Transcript: ENSMUST00000230403
Meta Mutation Damage Score 0.1050 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 96% (81/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor that recognizes the platelet-derived growth factor-responsive element in the matrix metalloproteinase 3 promoter. The encoded protein is thought to be a transcriptional coactivator, enhancing the activity of transcription factors such as JUN and SP1. Mutations in this gene are associated with autism spectrum disorders. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,067,635 S862G probably benign Het
2410089E03Rik T C 15: 8,270,803 V3198A unknown Het
Adgrf1 G A 17: 43,291,005 probably benign Het
Adss T G 1: 177,796,388 I3L probably benign Het
Anapc7 T A 5: 122,438,217 D302E probably benign Het
Ank3 A G 10: 69,953,476 probably null Het
Astn2 A C 4: 65,397,005 V1145G probably damaging Het
Babam2 C T 5: 32,007,230 probably benign Het
Blvrb A G 7: 27,465,846 H238R possibly damaging Het
Cacna1b C T 2: 24,706,216 V488I probably damaging Het
Ccdc88a C T 11: 29,463,409 T649M possibly damaging Het
Cdh12 A C 15: 21,583,912 S613R probably damaging Het
Cisd2 A G 3: 135,408,835 V125A probably benign Het
Clcn2 C A 16: 20,709,669 G478W possibly damaging Het
Cntnap2 T A 6: 47,107,969 H1121Q probably benign Het
Corin A T 5: 72,304,953 C876S probably damaging Het
Cox7c T C 13: 86,046,620 Y19C probably benign Het
Cspp1 T G 1: 10,134,126 L1038R probably damaging Het
Cwc15 A G 9: 14,504,938 K147E possibly damaging Het
Dlgap2 A G 8: 14,823,614 D739G probably benign Het
Dmxl2 A G 9: 54,369,189 probably benign Het
Dock5 A G 14: 67,805,756 V864A possibly damaging Het
Dock7 A G 4: 98,989,038 F1088L possibly damaging Het
Dpysl3 T C 18: 43,361,036 Y193C probably damaging Het
Dtna T C 18: 23,651,613 Y730H probably damaging Het
Dusp3 A G 11: 101,984,625 Y38H possibly damaging Het
Eif3m A T 2: 105,012,932 I151N probably damaging Het
Entpd2 C T 2: 25,399,726 T380I probably damaging Het
Epb41l3 C A 17: 69,286,800 H810N probably damaging Het
Fcrl5 A G 3: 87,446,391 T348A probably benign Het
Ginm1 A G 10: 7,779,314 S55P probably damaging Het
Glt1d1 C A 5: 127,657,084 probably null Het
Gm15433 T A 1: 84,964,112 noncoding transcript Het
Gm8221 A G 15: 77,626,152 noncoding transcript Het
Gramd1c A G 16: 43,983,241 V603A probably benign Het
Grm1 A G 10: 11,080,442 S33P probably benign Het
Gstp3 T C 19: 4,057,922 N137S possibly damaging Het
Kdm5d C T Y: 927,995 P756S probably benign Het
Ly75 A T 2: 60,311,771 L1332M possibly damaging Het
Med1 T A 11: 98,163,963 K378N probably damaging Het
Mn1 A G 5: 111,421,886 probably null Het
Mpo T C 11: 87,803,611 probably null Het
Nom1 C G 5: 29,441,379 R555G probably damaging Het
Nsmce4a C T 7: 130,538,170 R276Q probably benign Het
Nt5c G A 11: 115,490,817 probably null Het
Olfr472 T C 7: 107,903,491 I258T possibly damaging Het
Olfr670 G T 7: 104,959,996 H245Q probably damaging Het
Olfr908 CACAACAACA CACAACA 9: 38,516,138 probably benign Het
Pcdhga4 T C 18: 37,685,596 V66A probably damaging Het
Pik3c3 T C 18: 30,312,561 S534P probably benign Het
Pla2g4e A T 2: 120,186,395 C222S probably benign Het
Plch1 A C 3: 63,698,078 H1468Q probably benign Het
Psd2 T A 18: 36,007,503 W610R probably damaging Het
Ptgs1 A T 2: 36,251,186 K548N probably damaging Het
Ptprz1 T A 6: 23,007,355 V1639E probably damaging Het
Rangap1 A T 15: 81,706,494 S466T probably benign Het
Rgsl1 C T 1: 153,790,307 V986I probably benign Het
Rhobtb3 T C 13: 75,878,895 Y453C probably damaging Het
Rspry1 T C 8: 94,623,008 V8A probably benign Het
Rspry1 C A 8: 94,654,264 R399S probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Rxfp2 A G 5: 150,070,260 T596A probably benign Het
Sap18b G A 8: 95,825,370 A3T unknown Het
Serpina3j A G 12: 104,314,727 D53G probably damaging Het
Skint3 T A 4: 112,298,189 D381E possibly damaging Het
Slirp T C 12: 87,449,422 S96P possibly damaging Het
Snx6 T C 12: 54,770,728 E128G probably damaging Het
Stap1 A G 5: 86,090,928 T152A possibly damaging Het
Thap2 A T 10: 115,372,839 Y125* probably null Het
Ticrr T G 7: 79,690,942 Y1031* probably null Het
Tnrc18 G A 5: 142,740,156 R1793C unknown Het
Trpm3 C T 19: 22,926,184 R945* probably null Het
Ugt1a10 T A 1: 88,055,910 D143E probably damaging Het
Ush2a C T 1: 188,755,206 T3057M probably benign Het
Zc3h6 A T 2: 129,002,156 I207F possibly damaging Het
Zfp518a T C 19: 40,913,510 S628P probably benign Het
Zufsp T C 10: 33,927,466 N541D possibly damaging Het
Other mutations in Tcf20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Tcf20 APN 15 82854895 missense probably damaging 1.00
IGL00229:Tcf20 APN 15 82857142 missense possibly damaging 0.50
IGL00539:Tcf20 APN 15 82852756 missense probably benign 0.41
IGL00576:Tcf20 APN 15 82856075 missense probably damaging 1.00
IGL01135:Tcf20 APN 15 82853900 missense probably benign
IGL01670:Tcf20 APN 15 82855363 missense possibly damaging 0.77
IGL01684:Tcf20 APN 15 82857160 missense probably damaging 1.00
IGL01767:Tcf20 APN 15 82856008 missense probably damaging 1.00
IGL01825:Tcf20 APN 15 82852966 missense probably benign
IGL01834:Tcf20 APN 15 82855697 missense probably damaging 0.99
IGL01836:Tcf20 APN 15 82855155 missense probably damaging 0.99
IGL02415:Tcf20 APN 15 82853459 missense probably benign 0.28
IGL02731:Tcf20 APN 15 82853237 missense probably benign 0.00
IGL02739:Tcf20 APN 15 82856080 missense probably damaging 1.00
IGL03058:Tcf20 APN 15 82852004 missense probably damaging 0.96
PIT4131001:Tcf20 UTSW 15 82851584 missense probably damaging 0.96
R0184:Tcf20 UTSW 15 82852300 missense probably damaging 0.99
R0207:Tcf20 UTSW 15 82855085 missense probably benign
R0732:Tcf20 UTSW 15 82852303 missense probably benign 0.07
R1502:Tcf20 UTSW 15 82855576 missense probably damaging 1.00
R1575:Tcf20 UTSW 15 82855492 missense probably benign 0.19
R1719:Tcf20 UTSW 15 82852777 missense probably benign 0.03
R1997:Tcf20 UTSW 15 82857230 nonsense probably null
R2152:Tcf20 UTSW 15 82855602 missense probably damaging 1.00
R2173:Tcf20 UTSW 15 82854692 missense possibly damaging 0.62
R2288:Tcf20 UTSW 15 82851685 missense probably benign
R4049:Tcf20 UTSW 15 82853429 missense probably damaging 1.00
R4496:Tcf20 UTSW 15 82854984 missense probably damaging 1.00
R4704:Tcf20 UTSW 15 82851727 missense possibly damaging 0.49
R4892:Tcf20 UTSW 15 82854199 missense possibly damaging 0.80
R5164:Tcf20 UTSW 15 82856603 missense probably damaging 1.00
R5207:Tcf20 UTSW 15 82856185 missense probably damaging 0.98
R5219:Tcf20 UTSW 15 82856381 missense probably damaging 1.00
R5228:Tcf20 UTSW 15 82855955 missense probably benign 0.01
R5288:Tcf20 UTSW 15 82855709 missense possibly damaging 0.50
R5384:Tcf20 UTSW 15 82856199 missense probably damaging 0.99
R5677:Tcf20 UTSW 15 82853242 missense probably benign 0.05
R5897:Tcf20 UTSW 15 82851783 nonsense probably null
R6089:Tcf20 UTSW 15 82853208 missense probably benign 0.06
R6196:Tcf20 UTSW 15 82851986 missense possibly damaging 0.89
R6229:Tcf20 UTSW 15 82854880 missense probably damaging 1.00
R6448:Tcf20 UTSW 15 82852660 missense probably benign
R6688:Tcf20 UTSW 15 82854535 missense possibly damaging 0.68
R7009:Tcf20 UTSW 15 82854682 missense probably benign 0.07
R7051:Tcf20 UTSW 15 82856078 missense probably damaging 1.00
R7215:Tcf20 UTSW 15 82853489 missense probably benign
R7486:Tcf20 UTSW 15 82853734 missense possibly damaging 0.78
R7583:Tcf20 UTSW 15 82855276 missense possibly damaging 0.82
R7678:Tcf20 UTSW 15 82851565 missense possibly damaging 0.92
R8090:Tcf20 UTSW 15 82856006 missense probably damaging 1.00
R8156:Tcf20 UTSW 15 82852937 missense probably benign 0.00
R8191:Tcf20 UTSW 15 82853405 nonsense probably null
R8259:Tcf20 UTSW 15 82852273 missense probably damaging 1.00
R8339:Tcf20 UTSW 15 82852676 missense probably benign 0.04
R8447:Tcf20 UTSW 15 82853236 missense possibly damaging 0.77
R8497:Tcf20 UTSW 15 82855951 missense probably benign 0.07
R8728:Tcf20 UTSW 15 82854957 missense probably damaging 1.00
R8829:Tcf20 UTSW 15 82855714 missense probably damaging 1.00
R8861:Tcf20 UTSW 15 82852525 missense probably damaging 0.99
RF019:Tcf20 UTSW 15 82851593 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCCACCACAGTCTTCTGAGC -3'
(R):5'- GGAGCTGTTTGTACAATCATCAATG -3'

Sequencing Primer
(F):5'- CACAGTCTTCTGAGCGGTGG -3'
(R):5'- CCAAATTGGTGAGGAGCCG -3'
Posted On2016-09-06