Mutagenetix > Incidental Mutations

Incidental Mutation 'R5374:Tcf20'

428968

Institutional Source

Beutler Lab

Gene Symbol

Tcf20

Ensembl Gene

ENSMUSG00000041852

Gene Name

transcription factor 20

Synonyms

stromelysin 1 PDGF responsive element binding protein, 2810438H08Rik, SPBP

MMRRC Submission

042950-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.724) question?

Stock #

R5374 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

82808436-82987872 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 82851957 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 1764 (N1764K)

Ref Sequence

ENSEMBL: ENSMUSP00000105136 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048966] [ENSMUST00000109510] [ENSMUST00000229547] [ENSMUST00000230403]

AlphaFold

Q9EPQ8

Predicted Effect

probably damaging
Transcript: ENSMUST00000048966
AA Change: N1764K

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000048486
Gene: ENSMUSG00000041852
AA Change: N1764K

Domain	Start	End	E-Value	Type
low complexity region	42	74	N/A	INTRINSIC
coiled coil region	163	203	N/A	INTRINSIC
low complexity region	248	277	N/A	INTRINSIC
low complexity region	322	354	N/A	INTRINSIC
low complexity region	396	416	N/A	INTRINSIC
low complexity region	443	456	N/A	INTRINSIC
low complexity region	481	489	N/A	INTRINSIC
low complexity region	511	523	N/A	INTRINSIC
low complexity region	684	715	N/A	INTRINSIC
low complexity region	1047	1056	N/A	INTRINSIC
low complexity region	1532	1544	N/A	INTRINSIC
low complexity region	1577	1593	N/A	INTRINSIC
low complexity region	1602	1617	N/A	INTRINSIC
low complexity region	1793	1804	N/A	INTRINSIC
low complexity region	1860	1874	N/A	INTRINSIC
PHD	1913	1960	6.7e-6	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000109510
AA Change: N1764K

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000105136
Gene: ENSMUSG00000041852
AA Change: N1764K

Domain	Start	End	E-Value	Type
low complexity region	42	74	N/A	INTRINSIC
coiled coil region	163	203	N/A	INTRINSIC
low complexity region	248	277	N/A	INTRINSIC
low complexity region	322	354	N/A	INTRINSIC
low complexity region	396	416	N/A	INTRINSIC
low complexity region	443	456	N/A	INTRINSIC
low complexity region	481	489	N/A	INTRINSIC
low complexity region	511	523	N/A	INTRINSIC
low complexity region	684	715	N/A	INTRINSIC
low complexity region	1047	1056	N/A	INTRINSIC
low complexity region	1532	1544	N/A	INTRINSIC
low complexity region	1577	1593	N/A	INTRINSIC
low complexity region	1602	1617	N/A	INTRINSIC
low complexity region	1793	1804	N/A	INTRINSIC
low complexity region	1860	1874	N/A	INTRINSIC
PHD	1913	1960	6.7e-6	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000229547

Predicted Effect

probably benign
Transcript: ENSMUST00000230403

Meta Mutation Damage Score

0.1050

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.2%
20x: 95.2%

Validation Efficiency

96% (81/84)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor that recognizes the platelet-derived growth factor-responsive element in the matrix metalloproteinase 3 promoter. The encoded protein is thought to be a transcriptional coactivator, enhancing the activity of transcription factors such as JUN and SP1. Mutations in this gene are associated with autism spectrum disorders. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]

Allele List at MGI

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110002E22Rik	A	G	3: 138,067,635	S862G	probably benign	Het
2410089E03Rik	T	C	15: 8,270,803	V3198A	unknown	Het
Adgrf1	G	A	17: 43,291,005		probably benign	Het
Adss	T	G	1: 177,796,388	I3L	probably benign	Het
Anapc7	T	A	5: 122,438,217	D302E	probably benign	Het
Ank3	A	G	10: 69,953,476		probably null	Het
Astn2	A	C	4: 65,397,005	V1145G	probably damaging	Het
Babam2	C	T	5: 32,007,230		probably benign	Het
Blvrb	A	G	7: 27,465,846	H238R	possibly damaging	Het
Cacna1b	C	T	2: 24,706,216	V488I	probably damaging	Het
Ccdc88a	C	T	11: 29,463,409	T649M	possibly damaging	Het
Cdh12	A	C	15: 21,583,912	S613R	probably damaging	Het
Cisd2	A	G	3: 135,408,835	V125A	probably benign	Het
Clcn2	C	A	16: 20,709,669	G478W	possibly damaging	Het
Cntnap2	T	A	6: 47,107,969	H1121Q	probably benign	Het
Corin	A	T	5: 72,304,953	C876S	probably damaging	Het
Cox7c	T	C	13: 86,046,620	Y19C	probably benign	Het
Cspp1	T	G	1: 10,134,126	L1038R	probably damaging	Het
Cwc15	A	G	9: 14,504,938	K147E	possibly damaging	Het
Dlgap2	A	G	8: 14,823,614	D739G	probably benign	Het
Dmxl2	A	G	9: 54,369,189		probably benign	Het
Dock5	A	G	14: 67,805,756	V864A	possibly damaging	Het
Dock7	A	G	4: 98,989,038	F1088L	possibly damaging	Het
Dpysl3	T	C	18: 43,361,036	Y193C	probably damaging	Het
Dtna	T	C	18: 23,651,613	Y730H	probably damaging	Het
Dusp3	A	G	11: 101,984,625	Y38H	possibly damaging	Het
Eif3m	A	T	2: 105,012,932	I151N	probably damaging	Het
Entpd2	C	T	2: 25,399,726	T380I	probably damaging	Het
Epb41l3	C	A	17: 69,286,800	H810N	probably damaging	Het
Fcrl5	A	G	3: 87,446,391	T348A	probably benign	Het
Ginm1	A	G	10: 7,779,314	S55P	probably damaging	Het
Glt1d1	C	A	5: 127,657,084		probably null	Het
Gm15433	T	A	1: 84,964,112		noncoding transcript	Het
Gm8221	A	G	15: 77,626,152		noncoding transcript	Het
Gramd1c	A	G	16: 43,983,241	V603A	probably benign	Het
Grm1	A	G	10: 11,080,442	S33P	probably benign	Het
Gstp3	T	C	19: 4,057,922	N137S	possibly damaging	Het
Kdm5d	C	T	Y: 927,995	P756S	probably benign	Het
Ly75	A	T	2: 60,311,771	L1332M	possibly damaging	Het
Med1	T	A	11: 98,163,963	K378N	probably damaging	Het
Mn1	A	G	5: 111,421,886		probably null	Het
Mpo	T	C	11: 87,803,611		probably null	Het
Nom1	C	G	5: 29,441,379	R555G	probably damaging	Het
Nsmce4a	C	T	7: 130,538,170	R276Q	probably benign	Het
Nt5c	G	A	11: 115,490,817		probably null	Het
Olfr472	T	C	7: 107,903,491	I258T	possibly damaging	Het
Olfr670	G	T	7: 104,959,996	H245Q	probably damaging	Het
Olfr908	CACAACAACA	CACAACA	9: 38,516,138		probably benign	Het
Pcdhga4	T	C	18: 37,685,596	V66A	probably damaging	Het
Pik3c3	T	C	18: 30,312,561	S534P	probably benign	Het
Pla2g4e	A	T	2: 120,186,395	C222S	probably benign	Het
Plch1	A	C	3: 63,698,078	H1468Q	probably benign	Het
Psd2	T	A	18: 36,007,503	W610R	probably damaging	Het
Ptgs1	A	T	2: 36,251,186	K548N	probably damaging	Het
Ptprz1	T	A	6: 23,007,355	V1639E	probably damaging	Het
Rangap1	A	T	15: 81,706,494	S466T	probably benign	Het
Rgsl1	C	T	1: 153,790,307	V986I	probably benign	Het
Rhobtb3	T	C	13: 75,878,895	Y453C	probably damaging	Het
Rspry1	T	C	8: 94,623,008	V8A	probably benign	Het
Rspry1	C	A	8: 94,654,264	R399S	probably benign	Het
Rufy4	T	C	1: 74,147,663	C537R	probably damaging	Het
Rxfp2	A	G	5: 150,070,260	T596A	probably benign	Het
Sap18b	G	A	8: 95,825,370	A3T	unknown	Het
Serpina3j	A	G	12: 104,314,727	D53G	probably damaging	Het
Skint3	T	A	4: 112,298,189	D381E	possibly damaging	Het
Slirp	T	C	12: 87,449,422	S96P	possibly damaging	Het
Snx6	T	C	12: 54,770,728	E128G	probably damaging	Het
Stap1	A	G	5: 86,090,928	T152A	possibly damaging	Het
Thap2	A	T	10: 115,372,839	Y125*	probably null	Het
Ticrr	T	G	7: 79,690,942	Y1031*	probably null	Het
Tnrc18	G	A	5: 142,740,156	R1793C	unknown	Het
Trpm3	C	T	19: 22,926,184	R945*	probably null	Het
Ugt1a10	T	A	1: 88,055,910	D143E	probably damaging	Het
Ush2a	C	T	1: 188,755,206	T3057M	probably benign	Het
Zc3h6	A	T	2: 129,002,156	I207F	possibly damaging	Het
Zfp518a	T	C	19: 40,913,510	S628P	probably benign	Het
Zufsp	T	C	10: 33,927,466	N541D	possibly damaging	Het

Other mutations in Tcf20

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00087:Tcf20	APN	15	82854895	missense	probably damaging	1.00
IGL00229:Tcf20	APN	15	82857142	missense	possibly damaging	0.50
IGL00539:Tcf20	APN	15	82852756	missense	probably benign	0.41
IGL00576:Tcf20	APN	15	82856075	missense	probably damaging	1.00
IGL01135:Tcf20	APN	15	82853900	missense	probably benign
IGL01670:Tcf20	APN	15	82855363	missense	possibly damaging	0.77
IGL01684:Tcf20	APN	15	82857160	missense	probably damaging	1.00
IGL01767:Tcf20	APN	15	82856008	missense	probably damaging	1.00
IGL01825:Tcf20	APN	15	82852966	missense	probably benign
IGL01834:Tcf20	APN	15	82855697	missense	probably damaging	0.99
IGL01836:Tcf20	APN	15	82855155	missense	probably damaging	0.99
IGL02415:Tcf20	APN	15	82853459	missense	probably benign	0.28
IGL02731:Tcf20	APN	15	82853237	missense	probably benign	0.00
IGL02739:Tcf20	APN	15	82856080	missense	probably damaging	1.00
IGL03058:Tcf20	APN	15	82852004	missense	probably damaging	0.96
PIT4131001:Tcf20	UTSW	15	82851584	missense	probably damaging	0.96
R0184:Tcf20	UTSW	15	82852300	missense	probably damaging	0.99
R0207:Tcf20	UTSW	15	82855085	missense	probably benign
R0732:Tcf20	UTSW	15	82852303	missense	probably benign	0.07
R1502:Tcf20	UTSW	15	82855576	missense	probably damaging	1.00
R1575:Tcf20	UTSW	15	82855492	missense	probably benign	0.19
R1719:Tcf20	UTSW	15	82852777	missense	probably benign	0.03
R1997:Tcf20	UTSW	15	82857230	nonsense	probably null
R2152:Tcf20	UTSW	15	82855602	missense	probably damaging	1.00
R2173:Tcf20	UTSW	15	82854692	missense	possibly damaging	0.62
R2288:Tcf20	UTSW	15	82851685	missense	probably benign
R4049:Tcf20	UTSW	15	82853429	missense	probably damaging	1.00
R4496:Tcf20	UTSW	15	82854984	missense	probably damaging	1.00
R4704:Tcf20	UTSW	15	82851727	missense	possibly damaging	0.49
R4892:Tcf20	UTSW	15	82854199	missense	possibly damaging	0.80
R5164:Tcf20	UTSW	15	82856603	missense	probably damaging	1.00
R5207:Tcf20	UTSW	15	82856185	missense	probably damaging	0.98
R5219:Tcf20	UTSW	15	82856381	missense	probably damaging	1.00
R5228:Tcf20	UTSW	15	82855955	missense	probably benign	0.01
R5288:Tcf20	UTSW	15	82855709	missense	possibly damaging	0.50
R5384:Tcf20	UTSW	15	82856199	missense	probably damaging	0.99
R5677:Tcf20	UTSW	15	82853242	missense	probably benign	0.05
R5897:Tcf20	UTSW	15	82851783	nonsense	probably null
R6089:Tcf20	UTSW	15	82853208	missense	probably benign	0.06
R6196:Tcf20	UTSW	15	82851986	missense	possibly damaging	0.89
R6229:Tcf20	UTSW	15	82854880	missense	probably damaging	1.00
R6448:Tcf20	UTSW	15	82852660	missense	probably benign
R6688:Tcf20	UTSW	15	82854535	missense	possibly damaging	0.68
R7009:Tcf20	UTSW	15	82854682	missense	probably benign	0.07
R7051:Tcf20	UTSW	15	82856078	missense	probably damaging	1.00
R7215:Tcf20	UTSW	15	82853489	missense	probably benign
R7486:Tcf20	UTSW	15	82853734	missense	possibly damaging	0.78
R7583:Tcf20	UTSW	15	82855276	missense	possibly damaging	0.82
R7678:Tcf20	UTSW	15	82851565	missense	possibly damaging	0.92
R8090:Tcf20	UTSW	15	82856006	missense	probably damaging	1.00
R8156:Tcf20	UTSW	15	82852937	missense	probably benign	0.00
R8191:Tcf20	UTSW	15	82853405	nonsense	probably null
R8259:Tcf20	UTSW	15	82852273	missense	probably damaging	1.00
R8339:Tcf20	UTSW	15	82852676	missense	probably benign	0.04
R8447:Tcf20	UTSW	15	82853236	missense	possibly damaging	0.77
R8497:Tcf20	UTSW	15	82855951	missense	probably benign	0.07
R8728:Tcf20	UTSW	15	82854957	missense	probably damaging	1.00
R8829:Tcf20	UTSW	15	82855714	missense	probably damaging	1.00
R8861:Tcf20	UTSW	15	82852525	missense	probably damaging	0.99
RF019:Tcf20	UTSW	15	82851593	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TCCACCACAGTCTTCTGAGC -3'
(R):5'- GGAGCTGTTTGTACAATCATCAATG -3'

Sequencing Primer
(F):5'- CACAGTCTTCTGAGCGGTGG -3'
(R):5'- CCAAATTGGTGAGGAGCCG -3'

Posted On

2016-09-06