Incidental Mutation 'R5374:Dtna'
ID428974
Institutional Source Beutler Lab
Gene Symbol Dtna
Ensembl Gene ENSMUSG00000024302
Gene Namedystrobrevin alpha
Synonymsalpha-dystrobrevin, adbn, Dtn, a-DB-1, A0, 87K protein, 2210407P21Rik
MMRRC Submission 042950-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.492) question?
Stock #R5374 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location23415135-23659715 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 23651613 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 730 (Y730H)
Ref Sequence ENSEMBL: ENSMUSP00000152288 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115832] [ENSMUST00000220904] [ENSMUST00000222726]
Predicted Effect probably damaging
Transcript: ENSMUST00000115832
AA Change: Y666H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000111498
Gene: ENSMUSG00000024302
AA Change: Y666H

DomainStartEndE-ValueType
Pfam:EF-hand_2 16 140 1.7e-37 PFAM
Pfam:EF-hand_3 144 232 1.6e-32 PFAM
ZnF_ZZ 237 282 1.29e-17 SMART
SCOP:d1eq1a_ 361 494 5e-3 SMART
low complexity region 499 514 N/A INTRINSIC
coiled coil region 650 677 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220789
Predicted Effect probably damaging
Transcript: ENSMUST00000220904
AA Change: Y730H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect unknown
Transcript: ENSMUST00000222726
AA Change: Y16H
Meta Mutation Damage Score 0.1062 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 96% (81/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the dystrobrevin subfamily of the dystrophin family. This protein is a component of the dystrophin-associated protein complex (DPC), which consists of dystrophin and several integral and peripheral membrane proteins, including dystroglycans, sarcoglycans, syntrophins and alpha- and beta-dystrobrevin. The DPC localizes to the sarcolemma and its disruption is associated with various forms of muscular dystrophy. Mutations in this gene are associated with left ventricular noncompaction with congenital heart defects. Multiple alternatively spliced transcript variants encoding different isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous targeted mutants exhibit skeletal and cardiac myopathies. Neuromuscular junctions appear to form normally, but their postnatal maturation is compromised. Dtna mutations do not increase the severity of Dmd or Utrn mutants whose products are also part of the dystrophin-glycoprotein complex. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,067,635 S862G probably benign Het
2410089E03Rik T C 15: 8,270,803 V3198A unknown Het
Adgrf1 G A 17: 43,291,005 probably benign Het
Adss T G 1: 177,796,388 I3L probably benign Het
Anapc7 T A 5: 122,438,217 D302E probably benign Het
Ank3 A G 10: 69,953,476 probably null Het
Astn2 A C 4: 65,397,005 V1145G probably damaging Het
Babam2 C T 5: 32,007,230 probably benign Het
Blvrb A G 7: 27,465,846 H238R possibly damaging Het
Cacna1b C T 2: 24,706,216 V488I probably damaging Het
Ccdc88a C T 11: 29,463,409 T649M possibly damaging Het
Cdh12 A C 15: 21,583,912 S613R probably damaging Het
Cisd2 A G 3: 135,408,835 V125A probably benign Het
Clcn2 C A 16: 20,709,669 G478W possibly damaging Het
Cntnap2 T A 6: 47,107,969 H1121Q probably benign Het
Corin A T 5: 72,304,953 C876S probably damaging Het
Cox7c T C 13: 86,046,620 Y19C probably benign Het
Cspp1 T G 1: 10,134,126 L1038R probably damaging Het
Cwc15 A G 9: 14,504,938 K147E possibly damaging Het
Dlgap2 A G 8: 14,823,614 D739G probably benign Het
Dmxl2 A G 9: 54,369,189 probably benign Het
Dock5 A G 14: 67,805,756 V864A possibly damaging Het
Dock7 A G 4: 98,989,038 F1088L possibly damaging Het
Dpysl3 T C 18: 43,361,036 Y193C probably damaging Het
Dusp3 A G 11: 101,984,625 Y38H possibly damaging Het
Eif3m A T 2: 105,012,932 I151N probably damaging Het
Entpd2 C T 2: 25,399,726 T380I probably damaging Het
Epb41l3 C A 17: 69,286,800 H810N probably damaging Het
Fcrl5 A G 3: 87,446,391 T348A probably benign Het
Ginm1 A G 10: 7,779,314 S55P probably damaging Het
Glt1d1 C A 5: 127,657,084 probably null Het
Gm15433 T A 1: 84,964,112 noncoding transcript Het
Gm8221 A G 15: 77,626,152 noncoding transcript Het
Gramd1c A G 16: 43,983,241 V603A probably benign Het
Grm1 A G 10: 11,080,442 S33P probably benign Het
Gstp3 T C 19: 4,057,922 N137S possibly damaging Het
Kdm5d C T Y: 927,995 P756S probably benign Het
Ly75 A T 2: 60,311,771 L1332M possibly damaging Het
Med1 T A 11: 98,163,963 K378N probably damaging Het
Mn1 A G 5: 111,421,886 probably null Het
Mpo T C 11: 87,803,611 probably null Het
Nom1 C G 5: 29,441,379 R555G probably damaging Het
Nsmce4a C T 7: 130,538,170 R276Q probably benign Het
Nt5c G A 11: 115,490,817 probably null Het
Olfr472 T C 7: 107,903,491 I258T possibly damaging Het
Olfr670 G T 7: 104,959,996 H245Q probably damaging Het
Olfr908 CACAACAACA CACAACA 9: 38,516,138 probably benign Het
Pcdhga4 T C 18: 37,685,596 V66A probably damaging Het
Pik3c3 T C 18: 30,312,561 S534P probably benign Het
Pla2g4e A T 2: 120,186,395 C222S probably benign Het
Plch1 A C 3: 63,698,078 H1468Q probably benign Het
Psd2 T A 18: 36,007,503 W610R probably damaging Het
Ptgs1 A T 2: 36,251,186 K548N probably damaging Het
Ptprz1 T A 6: 23,007,355 V1639E probably damaging Het
Rangap1 A T 15: 81,706,494 S466T probably benign Het
Rgsl1 C T 1: 153,790,307 V986I probably benign Het
Rhobtb3 T C 13: 75,878,895 Y453C probably damaging Het
Rspry1 T C 8: 94,623,008 V8A probably benign Het
Rspry1 C A 8: 94,654,264 R399S probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Rxfp2 A G 5: 150,070,260 T596A probably benign Het
Sap18b G A 8: 95,825,370 A3T unknown Het
Serpina3j A G 12: 104,314,727 D53G probably damaging Het
Skint3 T A 4: 112,298,189 D381E possibly damaging Het
Slirp T C 12: 87,449,422 S96P possibly damaging Het
Snx6 T C 12: 54,770,728 E128G probably damaging Het
Stap1 A G 5: 86,090,928 T152A possibly damaging Het
Tcf20 A T 15: 82,851,957 N1764K probably damaging Het
Thap2 A T 10: 115,372,839 Y125* probably null Het
Ticrr T G 7: 79,690,942 Y1031* probably null Het
Tnrc18 G A 5: 142,740,156 R1793C unknown Het
Trpm3 C T 19: 22,926,184 R945* probably null Het
Ugt1a10 T A 1: 88,055,910 D143E probably damaging Het
Ush2a C T 1: 188,755,206 T3057M probably benign Het
Zc3h6 A T 2: 129,002,156 I207F possibly damaging Het
Zfp518a T C 19: 40,913,510 S628P probably benign Het
Zufsp T C 10: 33,927,466 N541D possibly damaging Het
Other mutations in Dtna
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00836:Dtna APN 18 23597488 missense probably benign 0.22
IGL01620:Dtna APN 18 23625087 missense probably damaging 1.00
IGL01705:Dtna APN 18 23545731 missense probably damaging 1.00
IGL01914:Dtna APN 18 23597459 missense possibly damaging 0.62
IGL02388:Dtna APN 18 23597514 missense probably benign 0.00
IGL02427:Dtna APN 18 23651538 missense possibly damaging 0.95
IGL03074:Dtna APN 18 23602605 missense possibly damaging 0.74
R0041:Dtna UTSW 18 23646875 unclassified probably benign
R0041:Dtna UTSW 18 23646875 unclassified probably benign
R0078:Dtna UTSW 18 23621442 missense probably damaging 1.00
R0390:Dtna UTSW 18 23597501 missense probably damaging 1.00
R1808:Dtna UTSW 18 23569640 missense probably damaging 1.00
R1872:Dtna UTSW 18 23597560 critical splice donor site probably null
R2095:Dtna UTSW 18 23569748 missense probably damaging 1.00
R2216:Dtna UTSW 18 23569565 missense probably damaging 1.00
R2295:Dtna UTSW 18 23631412 missense probably damaging 1.00
R2402:Dtna UTSW 18 23595478 nonsense probably null
R2846:Dtna UTSW 18 23651503 splice site probably null
R3836:Dtna UTSW 18 23625102 missense probably damaging 1.00
R4764:Dtna UTSW 18 23535149 splice site probably null
R4893:Dtna UTSW 18 23569667 missense probably damaging 0.99
R5194:Dtna UTSW 18 23590245 nonsense probably null
R5373:Dtna UTSW 18 23651613 missense probably damaging 1.00
R5526:Dtna UTSW 18 23646230 missense probably damaging 0.99
R5755:Dtna UTSW 18 23621463 missense probably benign
R5769:Dtna UTSW 18 23651554 missense probably benign 0.27
R6062:Dtna UTSW 18 23622056 missense possibly damaging 0.87
R6413:Dtna UTSW 18 23622014 missense probably damaging 1.00
R6876:Dtna UTSW 18 23611110 missense probably benign 0.00
R7103:Dtna UTSW 18 23653379 critical splice donor site probably null
R7711:Dtna UTSW 18 23625196 critical splice donor site probably null
R7804:Dtna UTSW 18 23595609 missense probably damaging 0.97
X0063:Dtna UTSW 18 23643168 missense probably damaging 0.98
X0066:Dtna UTSW 18 23592981 missense probably benign 0.38
Predicted Primers PCR Primer
(F):5'- TGAACTAGGGGTGTTCAGGC -3'
(R):5'- AAAACATTGTTGTCTGGGATGCG -3'

Sequencing Primer
(F):5'- TTCAGGCAGAACACATTAGGG -3'
(R):5'- ATGCGTGGACCGAGAATTCC -3'
Posted On2016-09-06