Incidental Mutation 'R5374:Gstp3'
ID428979
Institutional Source Beutler Lab
Gene Symbol Gstp3
Ensembl Gene ENSMUSG00000058216
Gene Nameglutathione S-transferase pi 3
SynonymsBC021614
MMRRC Submission 042950-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock #R5374 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location4057477-4059446 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 4057922 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 137 (N137S)
Ref Sequence ENSEMBL: ENSMUSP00000140159 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076451] [ENSMUST00000189808]
Predicted Effect probably benign
Transcript: ENSMUST00000076451
AA Change: N137S

PolyPhen 2 Score 0.129 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000075779
Gene: ENSMUSG00000058216
AA Change: N137S

DomainStartEndE-ValueType
Pfam:GST_N 3 75 4.1e-8 PFAM
Pfam:GST_C 77 188 4.6e-10 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000189808
AA Change: N137S

PolyPhen 2 Score 0.686 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000140159
Gene: ENSMUSG00000058216
AA Change: N137S

DomainStartEndE-ValueType
Pfam:GST_N 4 75 7.3e-15 PFAM
Pfam:GST_C 77 188 8.5e-13 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 96% (81/84)
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,067,635 S862G probably benign Het
2410089E03Rik T C 15: 8,270,803 V3198A unknown Het
Adgrf1 G A 17: 43,291,005 probably benign Het
Adss T G 1: 177,796,388 I3L probably benign Het
Anapc7 T A 5: 122,438,217 D302E probably benign Het
Ank3 A G 10: 69,953,476 probably null Het
Astn2 A C 4: 65,397,005 V1145G probably damaging Het
Babam2 C T 5: 32,007,230 probably benign Het
Blvrb A G 7: 27,465,846 H238R possibly damaging Het
Cacna1b C T 2: 24,706,216 V488I probably damaging Het
Ccdc88a C T 11: 29,463,409 T649M possibly damaging Het
Cdh12 A C 15: 21,583,912 S613R probably damaging Het
Cisd2 A G 3: 135,408,835 V125A probably benign Het
Clcn2 C A 16: 20,709,669 G478W possibly damaging Het
Cntnap2 T A 6: 47,107,969 H1121Q probably benign Het
Corin A T 5: 72,304,953 C876S probably damaging Het
Cox7c T C 13: 86,046,620 Y19C probably benign Het
Cspp1 T G 1: 10,134,126 L1038R probably damaging Het
Cwc15 A G 9: 14,504,938 K147E possibly damaging Het
Dlgap2 A G 8: 14,823,614 D739G probably benign Het
Dmxl2 A G 9: 54,369,189 probably benign Het
Dock5 A G 14: 67,805,756 V864A possibly damaging Het
Dock7 A G 4: 98,989,038 F1088L possibly damaging Het
Dpysl3 T C 18: 43,361,036 Y193C probably damaging Het
Dtna T C 18: 23,651,613 Y730H probably damaging Het
Dusp3 A G 11: 101,984,625 Y38H possibly damaging Het
Eif3m A T 2: 105,012,932 I151N probably damaging Het
Entpd2 C T 2: 25,399,726 T380I probably damaging Het
Epb41l3 C A 17: 69,286,800 H810N probably damaging Het
Fcrl5 A G 3: 87,446,391 T348A probably benign Het
Ginm1 A G 10: 7,779,314 S55P probably damaging Het
Glt1d1 C A 5: 127,657,084 probably null Het
Gm15433 T A 1: 84,964,112 noncoding transcript Het
Gm8221 A G 15: 77,626,152 noncoding transcript Het
Gramd1c A G 16: 43,983,241 V603A probably benign Het
Grm1 A G 10: 11,080,442 S33P probably benign Het
Kdm5d C T Y: 927,995 P756S probably benign Het
Ly75 A T 2: 60,311,771 L1332M possibly damaging Het
Med1 T A 11: 98,163,963 K378N probably damaging Het
Mn1 A G 5: 111,421,886 probably null Het
Mpo T C 11: 87,803,611 probably null Het
Nom1 C G 5: 29,441,379 R555G probably damaging Het
Nsmce4a C T 7: 130,538,170 R276Q probably benign Het
Nt5c G A 11: 115,490,817 probably null Het
Olfr472 T C 7: 107,903,491 I258T possibly damaging Het
Olfr670 G T 7: 104,959,996 H245Q probably damaging Het
Olfr908 CACAACAACA CACAACA 9: 38,516,138 probably benign Het
Pcdhga4 T C 18: 37,685,596 V66A probably damaging Het
Pik3c3 T C 18: 30,312,561 S534P probably benign Het
Pla2g4e A T 2: 120,186,395 C222S probably benign Het
Plch1 A C 3: 63,698,078 H1468Q probably benign Het
Psd2 T A 18: 36,007,503 W610R probably damaging Het
Ptgs1 A T 2: 36,251,186 K548N probably damaging Het
Ptprz1 T A 6: 23,007,355 V1639E probably damaging Het
Rangap1 A T 15: 81,706,494 S466T probably benign Het
Rgsl1 C T 1: 153,790,307 V986I probably benign Het
Rhobtb3 T C 13: 75,878,895 Y453C probably damaging Het
Rspry1 T C 8: 94,623,008 V8A probably benign Het
Rspry1 C A 8: 94,654,264 R399S probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Rxfp2 A G 5: 150,070,260 T596A probably benign Het
Sap18b G A 8: 95,825,370 A3T unknown Het
Serpina3j A G 12: 104,314,727 D53G probably damaging Het
Skint3 T A 4: 112,298,189 D381E possibly damaging Het
Slirp T C 12: 87,449,422 S96P possibly damaging Het
Snx6 T C 12: 54,770,728 E128G probably damaging Het
Stap1 A G 5: 86,090,928 T152A possibly damaging Het
Tcf20 A T 15: 82,851,957 N1764K probably damaging Het
Thap2 A T 10: 115,372,839 Y125* probably null Het
Ticrr T G 7: 79,690,942 Y1031* probably null Het
Tnrc18 G A 5: 142,740,156 R1793C unknown Het
Trpm3 C T 19: 22,926,184 R945* probably null Het
Ugt1a10 T A 1: 88,055,910 D143E probably damaging Het
Ush2a C T 1: 188,755,206 T3057M probably benign Het
Zc3h6 A T 2: 129,002,156 I207F possibly damaging Het
Zfp518a T C 19: 40,913,510 S628P probably benign Het
Zufsp T C 10: 33,927,466 N541D possibly damaging Het
Other mutations in Gstp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02239:Gstp3 APN 19 4057899 missense possibly damaging 0.49
IGL03065:Gstp3 APN 19 4058730 splice site probably null
IGL03162:Gstp3 APN 19 4059255 splice site probably benign
R0567:Gstp3 UTSW 19 4057636 missense possibly damaging 0.95
R1844:Gstp3 UTSW 19 4057540 missense probably benign 0.02
R2057:Gstp3 UTSW 19 4059282 missense probably damaging 1.00
R5221:Gstp3 UTSW 19 4057607 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- AGATTCAGAAGCACGTCCAGC -3'
(R):5'- CTGGTATGTAGGAGCCACAG -3'

Sequencing Primer
(F):5'- GTAGTCCGCGAAAGAGATCTAC -3'
(R):5'- GCCACAGGCTAGTGACCAAG -3'
Posted On2016-09-06