Mutagenetix > Incidental Mutation

Incidental Mutation 'R5374:Trpm3'

428980

Institutional Source

Beutler Lab

Gene Symbol

Trpm3

Ensembl Gene

ENSMUSG00000052387

Gene Name

transient receptor potential cation channel, subfamily M, member 3

Synonyms

B930001P07Rik, 6330504P12Rik, MLSN2, melastatin 2, LTRPC3

MMRRC Submission

042950-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.104) question?

Stock #

R5374 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

22139119-22989884 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

C to T at 22926184 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Stop codon at position 945 (R945*)

Ref Sequence

ENSEMBL: ENSMUSP00000097160 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000037901] [ENSMUST00000074770] [ENSMUST00000087576] [ENSMUST00000099564] [ENSMUST00000099569]

AlphaFold

J9S314

Predicted Effect

probably benign
Transcript: ENSMUST00000037901

SMART Domains

Protein: ENSMUSP00000042184
Gene: ENSMUSG00000052387

Domain	Start	End	E-Value	Type
Blast:ANK	485	514	1e-6	BLAST
low complexity region	619	631	N/A	INTRINSIC
low complexity region	674	689	N/A	INTRINSIC
low complexity region	788	800	N/A	INTRINSIC
low complexity region	821	840	N/A	INTRINSIC
Pfam:Ion_trans	883	1136	1.7e-19	PFAM
Pfam:TRPM_tetra	1227	1282	1.5e-26	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000074770

SMART Domains

Protein: ENSMUSP00000074328
Gene: ENSMUSG00000052387

Domain	Start	End	E-Value	Type
low complexity region	16	33	N/A	INTRINSIC
Blast:ANK	487	516	5e-7	BLAST
low complexity region	611	623	N/A	INTRINSIC
low complexity region	666	681	N/A	INTRINSIC
low complexity region	780	792	N/A	INTRINSIC
low complexity region	813	832	N/A	INTRINSIC
transmembrane domain	874	896	N/A	INTRINSIC
Pfam:Ion_trans	908	1116	5.1e-14	PFAM
low complexity region	1378	1388	N/A	INTRINSIC
low complexity region	1433	1455	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000087576

SMART Domains

Protein: ENSMUSP00000084857
Gene: ENSMUSG00000052387

Domain	Start	End	E-Value	Type
low complexity region	16	33	N/A	INTRINSIC
Blast:ANK	487	516	5e-7	BLAST
low complexity region	621	633	N/A	INTRINSIC
low complexity region	676	691	N/A	INTRINSIC
low complexity region	790	802	N/A	INTRINSIC
low complexity region	823	842	N/A	INTRINSIC
transmembrane domain	884	906	N/A	INTRINSIC
Pfam:Ion_trans	918	1126	5.1e-14	PFAM
low complexity region	1388	1398	N/A	INTRINSIC
low complexity region	1443	1465	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000099564
AA Change: R945*

SMART Domains

Protein: ENSMUSP00000097160
Gene: ENSMUSG00000052387
AA Change: R945*

Domain	Start	End	E-Value	Type
low complexity region	451	463	N/A	INTRINSIC
low complexity region	506	521	N/A	INTRINSIC
low complexity region	620	632	N/A	INTRINSIC
low complexity region	653	672	N/A	INTRINSIC
transmembrane domain	714	736	N/A	INTRINSIC
Pfam:Ion_trans	748	919	1.5e-13	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000099569

SMART Domains

Protein: ENSMUSP00000097164
Gene: ENSMUSG00000052387

Domain	Start	End	E-Value	Type
low complexity region	16	33	N/A	INTRINSIC
Blast:ANK	487	516	6e-7	BLAST
low complexity region	609	621	N/A	INTRINSIC
low complexity region	664	679	N/A	INTRINSIC
low complexity region	778	790	N/A	INTRINSIC
low complexity region	811	830	N/A	INTRINSIC
Pfam:Ion_trans	873	1138	3.2e-19	PFAM
Pfam:TRPM_tetra	1229	1284	4.4e-26	PFAM
low complexity region	1388	1398	N/A	INTRINSIC
low complexity region	1443	1465	N/A	INTRINSIC

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.2%
20x: 95.2%

Validation Efficiency

96% (81/84)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the family of transient receptor potential (TRP) channels. TRP channels are cation-selective channels important for cellular calcium signaling and homeostasis. The protein encoded by this gene mediates calcium entry, and this entry is potentiated by calcium store depletion. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display impaired thermal and chemical nociception. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110002E22Rik	A	G	3: 138,067,635	S862G	probably benign	Het
2410089E03Rik	T	C	15: 8,270,803	V3198A	unknown	Het
Adgrf1	G	A	17: 43,291,005		probably benign	Het
Adss	T	G	1: 177,796,388	I3L	probably benign	Het
Anapc7	T	A	5: 122,438,217	D302E	probably benign	Het
Ank3	A	G	10: 69,953,476		probably null	Het
Astn2	A	C	4: 65,397,005	V1145G	probably damaging	Het
Babam2	C	T	5: 32,007,230		probably benign	Het
Blvrb	A	G	7: 27,465,846	H238R	possibly damaging	Het
Cacna1b	C	T	2: 24,706,216	V488I	probably damaging	Het
Ccdc88a	C	T	11: 29,463,409	T649M	possibly damaging	Het
Cdh12	A	C	15: 21,583,912	S613R	probably damaging	Het
Cisd2	A	G	3: 135,408,835	V125A	probably benign	Het
Clcn2	C	A	16: 20,709,669	G478W	possibly damaging	Het
Cntnap2	T	A	6: 47,107,969	H1121Q	probably benign	Het
Corin	A	T	5: 72,304,953	C876S	probably damaging	Het
Cox7c	T	C	13: 86,046,620	Y19C	probably benign	Het
Cspp1	T	G	1: 10,134,126	L1038R	probably damaging	Het
Cwc15	A	G	9: 14,504,938	K147E	possibly damaging	Het
Dlgap2	A	G	8: 14,823,614	D739G	probably benign	Het
Dmxl2	A	G	9: 54,369,189		probably benign	Het
Dock5	A	G	14: 67,805,756	V864A	possibly damaging	Het
Dock7	A	G	4: 98,989,038	F1088L	possibly damaging	Het
Dpysl3	T	C	18: 43,361,036	Y193C	probably damaging	Het
Dtna	T	C	18: 23,651,613	Y730H	probably damaging	Het
Dusp3	A	G	11: 101,984,625	Y38H	possibly damaging	Het
Eif3m	A	T	2: 105,012,932	I151N	probably damaging	Het
Entpd2	C	T	2: 25,399,726	T380I	probably damaging	Het
Epb41l3	C	A	17: 69,286,800	H810N	probably damaging	Het
Fcrl5	A	G	3: 87,446,391	T348A	probably benign	Het
Ginm1	A	G	10: 7,779,314	S55P	probably damaging	Het
Glt1d1	C	A	5: 127,657,084		probably null	Het
Gm15433	T	A	1: 84,964,112		noncoding transcript	Het
Gm8221	A	G	15: 77,626,152		noncoding transcript	Het
Gramd1c	A	G	16: 43,983,241	V603A	probably benign	Het
Grm1	A	G	10: 11,080,442	S33P	probably benign	Het
Gstp3	T	C	19: 4,057,922	N137S	possibly damaging	Het
Kdm5d	C	T	Y: 927,995	P756S	probably benign	Het
Ly75	A	T	2: 60,311,771	L1332M	possibly damaging	Het
Med1	T	A	11: 98,163,963	K378N	probably damaging	Het
Mn1	A	G	5: 111,421,886		probably null	Het
Mpo	T	C	11: 87,803,611		probably null	Het
Nom1	C	G	5: 29,441,379	R555G	probably damaging	Het
Nsmce4a	C	T	7: 130,538,170	R276Q	probably benign	Het
Nt5c	G	A	11: 115,490,817		probably null	Het
Olfr472	T	C	7: 107,903,491	I258T	possibly damaging	Het
Olfr670	G	T	7: 104,959,996	H245Q	probably damaging	Het
Olfr908	CACAACAACA	CACAACA	9: 38,516,138		probably benign	Het
Pcdhga4	T	C	18: 37,685,596	V66A	probably damaging	Het
Pik3c3	T	C	18: 30,312,561	S534P	probably benign	Het
Pla2g4e	A	T	2: 120,186,395	C222S	probably benign	Het
Plch1	A	C	3: 63,698,078	H1468Q	probably benign	Het
Psd2	T	A	18: 36,007,503	W610R	probably damaging	Het
Ptgs1	A	T	2: 36,251,186	K548N	probably damaging	Het
Ptprz1	T	A	6: 23,007,355	V1639E	probably damaging	Het
Rangap1	A	T	15: 81,706,494	S466T	probably benign	Het
Rgsl1	C	T	1: 153,790,307	V986I	probably benign	Het
Rhobtb3	T	C	13: 75,878,895	Y453C	probably damaging	Het
Rspry1	T	C	8: 94,623,008	V8A	probably benign	Het
Rspry1	C	A	8: 94,654,264	R399S	probably benign	Het
Rufy4	T	C	1: 74,147,663	C537R	probably damaging	Het
Rxfp2	A	G	5: 150,070,260	T596A	probably benign	Het
Sap18b	G	A	8: 95,825,370	A3T	unknown	Het
Serpina3j	A	G	12: 104,314,727	D53G	probably damaging	Het
Skint3	T	A	4: 112,298,189	D381E	possibly damaging	Het
Slirp	T	C	12: 87,449,422	S96P	possibly damaging	Het
Snx6	T	C	12: 54,770,728	E128G	probably damaging	Het
Stap1	A	G	5: 86,090,928	T152A	possibly damaging	Het
Tcf20	A	T	15: 82,851,957	N1764K	probably damaging	Het
Thap2	A	T	10: 115,372,839	Y125*	probably null	Het
Ticrr	T	G	7: 79,690,942	Y1031*	probably null	Het
Tnrc18	G	A	5: 142,740,156	R1793C	unknown	Het
Ugt1a10	T	A	1: 88,055,910	D143E	probably damaging	Het
Ush2a	C	T	1: 188,755,206	T3057M	probably benign	Het
Zc3h6	A	T	2: 129,002,156	I207F	possibly damaging	Het
Zfp518a	T	C	19: 40,913,510	S628P	probably benign	Het
Zufsp	T	C	10: 33,927,466	N541D	possibly damaging	Het

Other mutations in Trpm3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00514:Trpm3	APN	19	22987659	missense	probably benign	0.00
IGL00773:Trpm3	APN	19	22900159	missense	possibly damaging	0.92
IGL00852:Trpm3	APN	19	22987071	missense	possibly damaging	0.93
IGL01597:Trpm3	APN	19	22715246	missense	probably damaging	1.00
IGL01607:Trpm3	APN	19	22987127	missense	probably benign	0.01
IGL01818:Trpm3	APN	19	22914474	missense	probably damaging	1.00
IGL01890:Trpm3	APN	19	22711719	missense	probably damaging	0.98
IGL02016:Trpm3	APN	19	22902069	nonsense	probably null
IGL02324:Trpm3	APN	19	22698779	missense	probably benign	0.25
IGL02947:Trpm3	APN	19	22901119	missense	probably damaging	0.99
IGL03037:Trpm3	APN	19	22889412	missense	possibly damaging	0.85
IGL03128:Trpm3	APN	19	22914465	missense	probably damaging	1.00
IGL03335:Trpm3	APN	19	22926071	critical splice donor site	probably null
IGL03354:Trpm3	APN	19	22856718	missense	probably damaging	1.00
bit	UTSW	19	22987869	missense	probably benign	0.00
G1patch:Trpm3	UTSW	19	22926028	missense	probably damaging	1.00
P0041:Trpm3	UTSW	19	22897686	missense	probably benign	0.01
R0001:Trpm3	UTSW	19	22715331	missense	possibly damaging	0.70
R0007:Trpm3	UTSW	19	22987529	missense	probably benign	0.00
R0007:Trpm3	UTSW	19	22987529	missense	probably benign	0.00
R0009:Trpm3	UTSW	19	22914446	missense	probably damaging	1.00
R0009:Trpm3	UTSW	19	22914446	missense	probably damaging	1.00
R0142:Trpm3	UTSW	19	22987916	missense	probably damaging	0.98
R0194:Trpm3	UTSW	19	22715356	splice site	probably null
R0268:Trpm3	UTSW	19	22897521	critical splice donor site	probably null
R0299:Trpm3	UTSW	19	22986873	missense	possibly damaging	0.62
R0449:Trpm3	UTSW	19	22988054	missense	probably benign
R0481:Trpm3	UTSW	19	22901071	missense	possibly damaging	0.51
R0496:Trpm3	UTSW	19	22698778	missense	probably benign	0.00
R0499:Trpm3	UTSW	19	22986873	missense	possibly damaging	0.62
R0550:Trpm3	UTSW	19	22987812	missense	probably damaging	0.97
R0729:Trpm3	UTSW	19	22987789	missense	probably benign
R0883:Trpm3	UTSW	19	22978654	missense	probably damaging	1.00
R0926:Trpm3	UTSW	19	22988043	missense	probably benign	0.02
R1185:Trpm3	UTSW	19	22914417	splice site	probably benign
R1185:Trpm3	UTSW	19	22914417	splice site	probably benign
R1513:Trpm3	UTSW	19	22986872	missense	possibly damaging	0.96
R1521:Trpm3	UTSW	19	22901221	missense	probably damaging	1.00
R1522:Trpm3	UTSW	19	22978334	missense	probably benign	0.39
R1569:Trpm3	UTSW	19	22889445	critical splice donor site	probably null
R1598:Trpm3	UTSW	19	22733024	missense	possibly damaging	0.47
R1600:Trpm3	UTSW	19	22139155	missense	probably benign	0.00
R1616:Trpm3	UTSW	19	22982712	missense	probably damaging	1.00
R1619:Trpm3	UTSW	19	22711907	missense	probably damaging	0.99
R1923:Trpm3	UTSW	19	22885412	missense	probably damaging	1.00
R1985:Trpm3	UTSW	19	22926082	missense	possibly damaging	0.56
R2002:Trpm3	UTSW	19	22982583	missense	probably damaging	1.00
R2249:Trpm3	UTSW	19	22733034	missense	probably benign	0.15
R3719:Trpm3	UTSW	19	22986990	missense	possibly damaging	0.95
R3766:Trpm3	UTSW	19	22448377	missense	probably benign
R3774:Trpm3	UTSW	19	22978602	missense	possibly damaging	0.66
R3774:Trpm3	UTSW	19	22987975	missense	probably benign	0.03
R3776:Trpm3	UTSW	19	22978602	missense	possibly damaging	0.66
R3820:Trpm3	UTSW	19	22987449	missense	probably benign	0.00
R3899:Trpm3	UTSW	19	22901160	missense	possibly damaging	0.90
R4204:Trpm3	UTSW	19	22987564	missense	probably benign	0.00
R4238:Trpm3	UTSW	19	22978638	missense	probably damaging	1.00
R4301:Trpm3	UTSW	19	22987292	missense	probably benign	0.23
R4344:Trpm3	UTSW	19	22897697	missense	probably damaging	0.99
R4345:Trpm3	UTSW	19	22897697	missense	probably damaging	0.99
R4365:Trpm3	UTSW	19	22978330	missense	probably benign	0.00
R4510:Trpm3	UTSW	19	22988017	missense	probably benign	0.00
R4511:Trpm3	UTSW	19	22988017	missense	probably benign	0.00
R4565:Trpm3	UTSW	19	22987869	missense	probably benign	0.00
R4573:Trpm3	UTSW	19	22902142	missense	probably damaging	1.00
R4606:Trpm3	UTSW	19	22978624	missense	probably benign	0.26
R4677:Trpm3	UTSW	19	22987388	missense	possibly damaging	0.95
R4684:Trpm3	UTSW	19	22987781	missense	probably benign
R4713:Trpm3	UTSW	19	22889435	missense	possibly damaging	0.83
R4745:Trpm3	UTSW	19	22715295	missense	possibly damaging	0.67
R5015:Trpm3	UTSW	19	22711712	missense	probably damaging	1.00
R5030:Trpm3	UTSW	19	22698766	missense	probably benign	0.01
R5074:Trpm3	UTSW	19	22885349	missense	possibly damaging	0.65
R5089:Trpm3	UTSW	19	22766756	missense	probably damaging	0.97
R5100:Trpm3	UTSW	19	22918766	missense	probably damaging	0.99
R5108:Trpm3	UTSW	19	22904714	missense	probably benign	0.06
R5204:Trpm3	UTSW	19	22448341	nonsense	probably null
R5213:Trpm3	UTSW	19	22697454	nonsense	probably null
R5358:Trpm3	UTSW	19	22925968	missense	probably damaging	1.00
R5382:Trpm3	UTSW	19	22885341	splice site	probably null
R5509:Trpm3	UTSW	19	22987258	missense	probably damaging	0.99
R5558:Trpm3	UTSW	19	22978573	missense	probably damaging	1.00
R6154:Trpm3	UTSW	19	22987814	missense	probably damaging	1.00
R6250:Trpm3	UTSW	19	22910054	missense	probably benign	0.01
R6433:Trpm3	UTSW	19	22901305	missense	probably damaging	1.00
R6542:Trpm3	UTSW	19	22926113	missense	probably benign	0.04
R6630:Trpm3	UTSW	19	22987983	missense	probably benign	0.00
R6640:Trpm3	UTSW	19	22978582	missense	probably damaging	1.00
R6725:Trpm3	UTSW	19	22926028	missense	probably damaging	1.00
R7275:Trpm3	UTSW	19	22978684	missense	possibly damaging	0.71
R7371:Trpm3	UTSW	19	22902193	missense	probably benign	0.27
R7467:Trpm3	UTSW	19	22978334	missense	possibly damaging	0.82
R7488:Trpm3	UTSW	19	22978573	missense	probably damaging	1.00
R7495:Trpm3	UTSW	19	22897796	missense	probably benign	0.28
R7600:Trpm3	UTSW	19	22926094	missense	possibly damaging	0.68
R7710:Trpm3	UTSW	19	22918790	missense	probably damaging	0.97
R7877:Trpm3	UTSW	19	22904784	missense	probably benign	0.25
R8184:Trpm3	UTSW	19	22918696	missense	possibly damaging	0.46
R8234:Trpm3	UTSW	19	22715276	missense	possibly damaging	0.47
R8236:Trpm3	UTSW	19	22987408	missense	probably benign	0.00
R8443:Trpm3	UTSW	19	22698862	missense	possibly damaging	0.90
R8470:Trpm3	UTSW	19	22910137	missense	possibly damaging	0.91
R8784:Trpm3	UTSW	19	22918676	missense	probably benign	0.07
R8816:Trpm3	UTSW	19	22988216	missense	probably damaging	0.97
R8818:Trpm3	UTSW	19	22978588	missense	possibly damaging	0.81
R8875:Trpm3	UTSW	19	22910129	missense	probably damaging	1.00
R8931:Trpm3	UTSW	19	22766670	missense	probably damaging	1.00
R8969:Trpm3	UTSW	19	22925944	missense	probably damaging	0.98
R8987:Trpm3	UTSW	19	22918760	missense	probably damaging	1.00
R9300:Trpm3	UTSW	19	22978381	missense	possibly damaging	0.49
R9327:Trpm3	UTSW	19	22918640	missense	possibly damaging	0.56
R9354:Trpm3	UTSW	19	22448332	missense	probably benign
R9514:Trpm3	UTSW	19	22982676	missense	probably benign	0.42
R9545:Trpm3	UTSW	19	22901094	missense	probably benign	0.24
R9712:Trpm3	UTSW	19	22715352	missense	possibly damaging	0.55
R9721:Trpm3	UTSW	19	22889398	missense	probably benign	0.00
R9750:Trpm3	UTSW	19	22926131	missense	probably benign	0.00
Z1176:Trpm3	UTSW	19	22987490	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TGAGGAGCCATCTTGGAAAC -3'
(R):5'- ACGTGGCCTTAAGATTTTGAGC -3'

Sequencing Primer
(F):5'- AGCCATCTTGGAAACTGGCC -3'
(R):5'- GGCCTTAAGATTTTGAGCTATATGC -3'

Posted On

2016-09-06