Mutagenetix > Incidental Mutations

Incidental Mutation 'R5375:AI314180'

429000

Institutional Source

Beutler Lab

Gene Symbol

AI314180

Ensembl Gene

ENSMUSG00000050812

Gene Name

expressed sequence AI314180

Synonyms

MMRRC Submission

042951-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.386) question?

Stock #

R5375 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

58798911-58912749 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

T to A at 58809401 bp

Zygosity

Heterozygous

Amino Acid Change

Lysine to Stop codon at position 1658 (K1658*)

Ref Sequence

ENSEMBL: ENSMUSP00000099953 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000102889] [ENSMUST00000149301]

Predicted Effect

probably null
Transcript: ENSMUST00000102889
AA Change: K1658*

SMART Domains

Protein: ENSMUSP00000099953
Gene: ENSMUSG00000050812
AA Change: K1658*

Domain	Start	End	E-Value	Type
Pfam:Ecm29	10	517	1.1e-155	PFAM
low complexity region	627	642	N/A	INTRINSIC
low complexity region	653	665	N/A	INTRINSIC
SCOP:d1qbkb_	693	1491	3e-31	SMART
low complexity region	1781	1797	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000149301

SMART Domains

Protein: ENSMUSP00000117585
Gene: ENSMUSG00000050812

Domain	Start	End	E-Value	Type
Pfam:Ecm29	10	517	4e-163	PFAM
low complexity region	627	642	N/A	INTRINSIC
low complexity region	653	665	N/A	INTRINSIC
SCOP:d1qbkb_	693	1490	8e-32	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149513

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.3%
20x: 95.4%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adcy3	T	A	12: 4,210,870	N995K	probably damaging	Het
Aldh4a1	T	C	4: 139,633,922	M60T	probably benign	Het
Alpk2	A	T	18: 65,372,738	H70Q	probably damaging	Het
Babam2	T	A	5: 31,701,863	I5N	possibly damaging	Het
Blm	T	C	7: 80,513,229	T125A	probably benign	Het
Bloc1s1	T	C	10: 128,923,957		probably benign	Het
Calcr	G	T	6: 3,714,651	Q160K	probably benign	Het
Ccdc43	C	T	11: 102,690,232	A131T	probably damaging	Het
Cdh15	A	T	8: 122,865,100	N575Y	probably damaging	Het
Chd8	T	C	14: 52,204,154	D827G	probably damaging	Het
Col3a1	A	G	1: 45,347,899		probably null	Het
Creb5	A	T	6: 53,681,017	M255L	possibly damaging	Het
Cst8	A	G	2: 148,804,583	I78V	probably benign	Het
Cyld	A	G	8: 88,733,036	E440G	possibly damaging	Het
Cyp2b9	A	C	7: 26,187,742	D192A	probably damaging	Het
Dclre1b	C	T	3: 103,803,974	R207H	probably damaging	Het
Dnah6	A	T	6: 73,123,855	F1936L	probably damaging	Het
Dpp9	A	C	17: 56,189,424	Y761*	probably null	Het
Drc1	A	T	5: 30,356,401	M434L	probably benign	Het
Dtx3l	A	T	16: 35,933,027	I403N	probably damaging	Het
Efcab9	A	G	11: 32,527,484	Y13H	probably damaging	Het
Efhb	T	A	17: 53,401,626	N672I	possibly damaging	Het
Eif5b	T	C	1: 38,045,754	V894A	possibly damaging	Het
Elovl3	T	C	19: 46,134,696	F237S	probably benign	Het
Emc1	T	A	4: 139,366,491	D637E	probably damaging	Het
Erbb2	C	A	11: 98,433,412	P742Q	probably damaging	Het
Fam234b	C	A	6: 135,233,357	L584M	probably damaging	Het
Fancd2	A	T	6: 113,568,712	D14V	possibly damaging	Het
Fat2	T	C	11: 55,262,820	H3522R	probably benign	Het
Fgfr2	T	C	7: 130,241,215	N147D	possibly damaging	Het
Gm26657	A	G	4: 56,741,180		probably benign	Het
Hcrtr1	C	T	4: 130,135,725	V188M	probably benign	Het
Herc1	T	C	9: 66,467,887	V3331A	probably damaging	Het
Hmcn2	T	C	2: 31,430,441	V3978A	possibly damaging	Het
Invs	G	A	4: 48,385,262	R202K	probably benign	Het
Lgr5	C	T	10: 115,478,564	S156N	probably benign	Het
Mras	T	G	9: 99,394,616	D67A	probably damaging	Het
Mrpl39	A	G	16: 84,723,902	L283P	probably damaging	Het
Ncoa6	A	T	2: 155,433,995	I110N	probably benign	Het
Neb	T	C	2: 52,212,584	D544G	possibly damaging	Het
Nlrc3	A	G	16: 3,964,753	I264T	possibly damaging	Het
Olfr180	T	C	16: 58,915,885	Y252C	possibly damaging	Het
Olfr341	A	G	2: 36,479,297	Y278H	probably damaging	Het
Olfr714	T	A	7: 107,073,873	M15K	probably benign	Het
Olfr830	A	G	9: 18,876,146	K273R	probably benign	Het
Otx1	C	A	11: 21,997,037	A91S	probably damaging	Het
Phf11d	T	C	14: 59,352,671	D234G	probably null	Het
Polq	A	T	16: 37,082,784	D1980V	probably damaging	Het
Rasa1	A	T	13: 85,288,903		probably benign	Het
Rufy4	T	C	1: 74,147,663	C537R	probably damaging	Het
Sec23a	A	G	12: 59,007,005	V69A	probably benign	Het
Sipa1	A	G	19: 5,659,612	I260T	probably damaging	Het
Smarcc1	T	A	9: 110,190,949	L628H	probably damaging	Het
Snx31	A	G	15: 36,525,584	V323A	probably damaging	Het
Sun2	A	G	15: 79,727,522	S565P	probably damaging	Het
Tmem74	C	T	15: 43,867,168	D160N	possibly damaging	Het
Tnik	T	C	3: 28,594,092	M431T	probably benign	Het
Trp53inp1	A	G	4: 11,165,305	T110A	probably benign	Het
Ttll9	G	T	2: 152,984,224	C118F	probably benign	Het
Vps4b	A	G	1: 106,791,692	L42P	probably benign	Het
Xirp2	A	T	2: 67,511,906	N1497I	probably damaging	Het
Xpo4	A	G	14: 57,638,307	V123A	probably damaging	Het
Zfhx4	A	T	3: 5,412,425	T3367S	probably damaging	Het
Zfp236	T	C	18: 82,597,688	E1782G	possibly damaging	Het
Zfp35	T	A	18: 24,002,916	C106S	possibly damaging	Het
Zfpm1	A	G	8: 122,336,073	T624A	probably benign	Het
Zmiz2	C	T	11: 6,397,519	Q276*	probably null	Het

Other mutations in AI314180

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00799:AI314180	APN	4	58828047	missense	possibly damaging	0.95
IGL01145:AI314180	APN	4	58811501	missense	probably null	0.08
IGL01371:AI314180	APN	4	58809718	missense	probably damaging	1.00
IGL01445:AI314180	APN	4	58833988	missense	probably benign	0.08
IGL01452:AI314180	APN	4	58836181	missense	probably damaging	0.99
IGL01626:AI314180	APN	4	58832814	splice site	probably benign
IGL01672:AI314180	APN	4	58814041	missense	probably benign	0.40
IGL01943:AI314180	APN	4	58849937	missense	possibly damaging	0.91
IGL01944:AI314180	APN	4	58861544	missense	probably benign	0.42
IGL02190:AI314180	APN	4	58800190	missense	probably benign	0.12
IGL02272:AI314180	APN	4	58811731	missense	probably benign	0.00
IGL02435:AI314180	APN	4	58830325	splice site	probably benign
IGL02516:AI314180	APN	4	58877102	missense	probably damaging	1.00
IGL02540:AI314180	APN	4	58805534	splice site	probably benign
IGL02709:AI314180	APN	4	58872699	missense	possibly damaging	0.90
IGL02742:AI314180	APN	4	58840757	missense	probably damaging	0.96
IGL02812:AI314180	APN	4	58864343	splice site	probably benign
IGL02828:AI314180	APN	4	58875512	missense	possibly damaging	0.59
IGL03130:AI314180	APN	4	58800288	missense	probably benign
IGL03179:AI314180	APN	4	58832777	missense	probably damaging	1.00
IGL03237:AI314180	APN	4	58810668	missense	probably benign	0.40
IGL03344:AI314180	APN	4	58828538	missense	probably damaging	1.00
R0051:AI314180	UTSW	4	58832729	missense	probably damaging	1.00
R0051:AI314180	UTSW	4	58832729	missense	probably damaging	1.00
R0313:AI314180	UTSW	4	58811892	missense	probably benign	0.11
R0399:AI314180	UTSW	4	58827047	missense	possibly damaging	0.69
R0487:AI314180	UTSW	4	58819155	missense	probably damaging	1.00
R0492:AI314180	UTSW	4	58864418	missense	probably damaging	1.00
R0705:AI314180	UTSW	4	58885366	critical splice donor site	probably null
R0847:AI314180	UTSW	4	58841439	missense	probably benign	0.14
R1467:AI314180	UTSW	4	58832753	missense	probably benign
R1467:AI314180	UTSW	4	58832753	missense	probably benign
R1482:AI314180	UTSW	4	58820163	missense	possibly damaging	0.85
R1529:AI314180	UTSW	4	58832701	splice site	probably null
R1771:AI314180	UTSW	4	58879100	missense	probably damaging	1.00
R1776:AI314180	UTSW	4	58879100	missense	probably damaging	1.00
R1822:AI314180	UTSW	4	58805539	critical splice donor site	probably null
R1864:AI314180	UTSW	4	58849942	missense	possibly damaging	0.62
R2029:AI314180	UTSW	4	58844165	nonsense	probably null
R2061:AI314180	UTSW	4	58824270	missense	probably damaging	1.00
R2125:AI314180	UTSW	4	58833978	missense	probably benign
R2266:AI314180	UTSW	4	58830332	critical splice donor site	probably null
R2889:AI314180	UTSW	4	58836165	missense	probably benign
R2902:AI314180	UTSW	4	58809691	missense	probably benign	0.31
R2903:AI314180	UTSW	4	58828622	missense	possibly damaging	0.50
R2925:AI314180	UTSW	4	58833928	nonsense	probably null
R4151:AI314180	UTSW	4	58836254	missense	possibly damaging	0.51
R4225:AI314180	UTSW	4	58847027	missense	probably damaging	1.00
R4486:AI314180	UTSW	4	58820086	intron	probably benign
R4576:AI314180	UTSW	4	58834708	intron	probably benign
R4580:AI314180	UTSW	4	58840751	missense	probably damaging	1.00
R4654:AI314180	UTSW	4	58834523	missense	possibly damaging	0.86
R4688:AI314180	UTSW	4	58840757	missense	probably damaging	0.96
R4726:AI314180	UTSW	4	58844191	missense	probably damaging	1.00
R4825:AI314180	UTSW	4	58850911	missense	probably damaging	0.99
R4928:AI314180	UTSW	4	58827073	missense	probably damaging	1.00
R5098:AI314180	UTSW	4	58877048	missense	probably damaging	1.00
R5284:AI314180	UTSW	4	58836172	missense	possibly damaging	0.90
R5382:AI314180	UTSW	4	58850934	missense	probably benign	0.38
R5487:AI314180	UTSW	4	58809421	missense	probably benign	0.22
R5703:AI314180	UTSW	4	58877171	splice site	probably null
R5761:AI314180	UTSW	4	58853131	missense	probably damaging	1.00
R5791:AI314180	UTSW	4	58814027	missense	possibly damaging	0.90
R5791:AI314180	UTSW	4	58822111	missense	probably damaging	1.00
R5928:AI314180	UTSW	4	58849948	missense	possibly damaging	0.59
R6062:AI314180	UTSW	4	58826453	missense	possibly damaging	0.84
R6246:AI314180	UTSW	4	58811365	splice site	probably null
R6298:AI314180	UTSW	4	58877157	missense	probably damaging	1.00
R6326:AI314180	UTSW	4	58827068	missense	probably benign	0.34
R6478:AI314180	UTSW	4	58810785	missense	probably damaging	1.00
R6707:AI314180	UTSW	4	58879101	missense	possibly damaging	0.52
R6846:AI314180	UTSW	4	58814081	missense	possibly damaging	0.85
R6857:AI314180	UTSW	4	58814065	missense	probably damaging	1.00
R6951:AI314180	UTSW	4	58853114	critical splice donor site	probably null
R7088:AI314180	UTSW	4	58849766	missense	possibly damaging	0.93
R7302:AI314180	UTSW	4	58834593	missense	probably benign	0.43
R7337:AI314180	UTSW	4	58827047	missense	possibly damaging	0.69
R7341:AI314180	UTSW	4	58809415	missense	possibly damaging	0.94
R7344:AI314180	UTSW	4	58824770	missense	probably benign	0.08
R7525:AI314180	UTSW	4	58847038	missense	possibly damaging	0.84
R7530:AI314180	UTSW	4	58815317	missense	probably damaging	0.99
R7533:AI314180	UTSW	4	58809411	missense	probably benign	0.12
R7557:AI314180	UTSW	4	58849691	missense	possibly damaging	0.85
X0060:AI314180	UTSW	4	58840752	missense	possibly damaging	0.73

Predicted Primers

PCR Primer
(F):5'- TACTCTGTCATCTGCCTGGG -3'
(R):5'- AGTCTGTGCCCAATCAACCC -3'

Sequencing Primer
(F):5'- AGGATCCCTGAATACTTTATGGGGC -3'
(R):5'- CACCACAAATGAAATTCTTCAGGCTG -3'

Posted On

2016-09-06