Incidental Mutation 'R5375:Babam2'
ID429005
Institutional Source Beutler Lab
Gene Symbol Babam2
Ensembl Gene ENSMUSG00000052139
Gene NameBRISC and BRCA1 A complex member 2
SynonymsBre, 6030405P19Rik, B830038C02Rik
MMRRC Submission 042951-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.737) question?
Stock #R5375 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location31697684-32084962 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 31701863 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 5 (I5N)
Ref Sequence ENSEMBL: ENSMUSP00000143964 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031018] [ENSMUST00000063813] [ENSMUST00000071531] [ENSMUST00000114507] [ENSMUST00000114515] [ENSMUST00000131995] [ENSMUST00000200705] [ENSMUST00000201352] [ENSMUST00000202293] [ENSMUST00000202815]
Predicted Effect probably benign
Transcript: ENSMUST00000031018
SMART Domains Protein: ENSMUSP00000031018
Gene: ENSMUSG00000029136

DomainStartEndE-ValueType
Pfam:PfkB 16 315 2.1e-66 PFAM
Pfam:Phos_pyr_kin 166 306 9.6e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000063813
AA Change: I5N

PolyPhen 2 Score 0.233 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000069133
Gene: ENSMUSG00000052139
AA Change: I5N

DomainStartEndE-ValueType
Pfam:BRE 70 370 3.4e-133 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000071531
SMART Domains Protein: ENSMUSP00000071462
Gene: ENSMUSG00000052139

DomainStartEndE-ValueType
Pfam:BRE 28 324 2.2e-204 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114507
SMART Domains Protein: ENSMUSP00000110152
Gene: ENSMUSG00000052139

DomainStartEndE-ValueType
Pfam:BRE 3 269 9.5e-182 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000114514
AA Change: I37N
Predicted Effect probably benign
Transcript: ENSMUST00000114515
AA Change: I5N

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000110160
Gene: ENSMUSG00000052139
AA Change: I5N

DomainStartEndE-ValueType
Pfam:BRE 1 333 4.9e-235 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000125589
AA Change: I5N

PolyPhen 2 Score 0.524 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000132403
Gene: ENSMUSG00000052139
AA Change: I5N

DomainStartEndE-ValueType
Pfam:BRE 1 166 2.4e-120 PFAM
Pfam:BRE 166 204 2.1e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131995
SMART Domains Protein: ENSMUSP00000128351
Gene: ENSMUSG00000052139

DomainStartEndE-ValueType
Pfam:BRE 1 195 4.3e-131 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138996
AA Change: I72N
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142394
AA Change: L77M
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147592
AA Change: N34K
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152211
AA Change: I49N
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155155
AA Change: N40K
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200694
Predicted Effect possibly damaging
Transcript: ENSMUST00000200705
AA Change: I5N

PolyPhen 2 Score 0.524 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000143964
Gene: ENSMUSG00000052139
AA Change: I5N

DomainStartEndE-ValueType
Pfam:BRE 8 204 1.6e-72 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201107
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201202
Predicted Effect probably benign
Transcript: ENSMUST00000201352
AA Change: I5N

PolyPhen 2 Score 0.233 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000144205
Gene: ENSMUSG00000052139
AA Change: I5N

DomainStartEndE-ValueType
Pfam:BRE 8 333 8.1e-146 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201487
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201592
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202033
Predicted Effect probably benign
Transcript: ENSMUST00000202293
AA Change: I5N

PolyPhen 2 Score 0.188 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect probably benign
Transcript: ENSMUST00000202815
AA Change: I5N

PolyPhen 2 Score 0.188 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000144497
Gene: ENSMUSG00000052139
AA Change: I5N

DomainStartEndE-ValueType
Pfam:BRE 8 63 1.2e-14 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an anti-apoptotic, death receptor-associated protein that interacts with tumor necrosis factor-receptor-1. The encoded protein acts as an adapter in several protein complexes, including the BRCA1-A complex and the BRISC complex. The BRCA1-A complex possesses ubiquitinase activity and targets sites of double strand DNA breaks, while the BRISC complex exhibits deubiquitinase activity and is involved in mitotic spindle assembly. This gene is upregulated in several types of cancer. [provided by RefSeq, Jun 2016]
PHENOTYPE: Mice homozygous for a knock-out allele are fertile. However, fibroblasts exhibit decreased proliferation and increased cellular replicative senescence in response to irradiation and hydrogen peroxide with impaired DNA damage repair. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy3 T A 12: 4,210,870 N995K probably damaging Het
AI314180 T A 4: 58,809,401 K1658* probably null Het
Aldh4a1 T C 4: 139,633,922 M60T probably benign Het
Alpk2 A T 18: 65,372,738 H70Q probably damaging Het
Blm T C 7: 80,513,229 T125A probably benign Het
Bloc1s1 T C 10: 128,923,957 probably benign Het
Calcr G T 6: 3,714,651 Q160K probably benign Het
Ccdc43 C T 11: 102,690,232 A131T probably damaging Het
Cdh15 A T 8: 122,865,100 N575Y probably damaging Het
Chd8 T C 14: 52,204,154 D827G probably damaging Het
Col3a1 A G 1: 45,347,899 probably null Het
Creb5 A T 6: 53,681,017 M255L possibly damaging Het
Cst8 A G 2: 148,804,583 I78V probably benign Het
Cyld A G 8: 88,733,036 E440G possibly damaging Het
Cyp2b9 A C 7: 26,187,742 D192A probably damaging Het
Dclre1b C T 3: 103,803,974 R207H probably damaging Het
Dnah6 A T 6: 73,123,855 F1936L probably damaging Het
Dpp9 A C 17: 56,189,424 Y761* probably null Het
Drc1 A T 5: 30,356,401 M434L probably benign Het
Dtx3l A T 16: 35,933,027 I403N probably damaging Het
Efcab9 A G 11: 32,527,484 Y13H probably damaging Het
Efhb T A 17: 53,401,626 N672I possibly damaging Het
Eif5b T C 1: 38,045,754 V894A possibly damaging Het
Elovl3 T C 19: 46,134,696 F237S probably benign Het
Emc1 T A 4: 139,366,491 D637E probably damaging Het
Erbb2 C A 11: 98,433,412 P742Q probably damaging Het
Fam234b C A 6: 135,233,357 L584M probably damaging Het
Fancd2 A T 6: 113,568,712 D14V possibly damaging Het
Fat2 T C 11: 55,262,820 H3522R probably benign Het
Fgfr2 T C 7: 130,241,215 N147D possibly damaging Het
Gm26657 A G 4: 56,741,180 probably benign Het
Hcrtr1 C T 4: 130,135,725 V188M probably benign Het
Herc1 T C 9: 66,467,887 V3331A probably damaging Het
Hmcn2 T C 2: 31,430,441 V3978A possibly damaging Het
Invs G A 4: 48,385,262 R202K probably benign Het
Lgr5 C T 10: 115,478,564 S156N probably benign Het
Mras T G 9: 99,394,616 D67A probably damaging Het
Mrpl39 A G 16: 84,723,902 L283P probably damaging Het
Ncoa6 A T 2: 155,433,995 I110N probably benign Het
Neb T C 2: 52,212,584 D544G possibly damaging Het
Nlrc3 A G 16: 3,964,753 I264T possibly damaging Het
Olfr180 T C 16: 58,915,885 Y252C possibly damaging Het
Olfr341 A G 2: 36,479,297 Y278H probably damaging Het
Olfr714 T A 7: 107,073,873 M15K probably benign Het
Olfr830 A G 9: 18,876,146 K273R probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Phf11d T C 14: 59,352,671 D234G probably null Het
Polq A T 16: 37,082,784 D1980V probably damaging Het
Rasa1 A T 13: 85,288,903 probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sec23a A G 12: 59,007,005 V69A probably benign Het
Sipa1 A G 19: 5,659,612 I260T probably damaging Het
Smarcc1 T A 9: 110,190,949 L628H probably damaging Het
Snx31 A G 15: 36,525,584 V323A probably damaging Het
Sun2 A G 15: 79,727,522 S565P probably damaging Het
Tmem74 C T 15: 43,867,168 D160N possibly damaging Het
Tnik T C 3: 28,594,092 M431T probably benign Het
Trp53inp1 A G 4: 11,165,305 T110A probably benign Het
Ttll9 G T 2: 152,984,224 C118F probably benign Het
Vps4b A G 1: 106,791,692 L42P probably benign Het
Xirp2 A T 2: 67,511,906 N1497I probably damaging Het
Xpo4 A G 14: 57,638,307 V123A probably damaging Het
Zfhx4 A T 3: 5,412,425 T3367S probably damaging Het
Zfp236 T C 18: 82,597,688 E1782G possibly damaging Het
Zfp35 T A 18: 24,002,916 C106S possibly damaging Het
Zfpm1 A G 8: 122,336,073 T624A probably benign Het
Zmiz2 C T 11: 6,397,519 Q276* probably null Het
Other mutations in Babam2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00844:Babam2 APN 5 32007307 missense probably damaging 1.00
IGL01815:Babam2 APN 5 31702098 missense possibly damaging 0.90
IGL02869:Babam2 APN 5 32004772 missense possibly damaging 0.92
IGL03091:Babam2 APN 5 31785678 splice site probably null
IGL03185:Babam2 APN 5 31702032 missense possibly damaging 0.60
R1817:Babam2 UTSW 5 32057546 missense probably damaging 0.99
R4012:Babam2 UTSW 5 32001438 missense probably damaging 1.00
R4257:Babam2 UTSW 5 31702070 missense possibly damaging 0.76
R4522:Babam2 UTSW 5 32007242 missense probably damaging 1.00
R4622:Babam2 UTSW 5 32007312 missense probably damaging 0.99
R4738:Babam2 UTSW 5 31901142 missense probably damaging 0.99
R4752:Babam2 UTSW 5 31702047 intron probably benign
R4927:Babam2 UTSW 5 31702064 missense probably benign 0.00
R4962:Babam2 UTSW 5 31785583 missense possibly damaging 0.75
R5374:Babam2 UTSW 5 32007230 splice site probably benign
R5453:Babam2 UTSW 5 32007246 missense probably damaging 1.00
R5890:Babam2 UTSW 5 32064807 intron probably benign
R5915:Babam2 UTSW 5 31785611 missense probably damaging 1.00
R5982:Babam2 UTSW 5 31820620 missense possibly damaging 0.86
R6271:Babam2 UTSW 5 32001362 missense probably damaging 1.00
R7268:Babam2 UTSW 5 31701853 missense probably damaging 1.00
R7352:Babam2 UTSW 5 32007250 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTGGCTCCTGGAAGACTAAGTG -3'
(R):5'- CTTGAATGAAAGCTTCTGTGACG -3'

Sequencing Primer
(F):5'- CTCCTGGAAGACTAAGTGGTACTG -3'
(R):5'- GACGGCCCTTTTTCATGGATCTG -3'
Posted On2016-09-06