Incidental Mutation 'R5375:Blm'
ID 429012
Institutional Source Beutler Lab
Gene Symbol Blm
Ensembl Gene ENSMUSG00000030528
Gene Name Bloom syndrome, RecQ like helicase
Synonyms
MMRRC Submission 042951-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5375 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 80104741-80184896 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 80162977 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 125 (T125A)
Ref Sequence ENSEMBL: ENSMUSP00000127995 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081314] [ENSMUST00000170315]
AlphaFold O88700
Predicted Effect probably benign
Transcript: ENSMUST00000081314
AA Change: T122A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000080062
Gene: ENSMUSG00000030528
AA Change: T122A

DomainStartEndE-ValueType
low complexity region 46 54 N/A INTRINSIC
low complexity region 118 132 N/A INTRINSIC
low complexity region 142 169 N/A INTRINSIC
low complexity region 219 231 N/A INTRINSIC
low complexity region 318 335 N/A INTRINSIC
Pfam:BDHCT 376 416 5.5e-27 PFAM
low complexity region 557 574 N/A INTRINSIC
DEXDc 672 873 1.59e-29 SMART
HELICc 910 992 1.29e-24 SMART
RQC 1084 1198 1.43e-15 SMART
HRDC 1217 1297 9.4e-20 SMART
low complexity region 1357 1371 N/A INTRINSIC
low complexity region 1378 1392 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166096
Predicted Effect probably benign
Transcript: ENSMUST00000170315
AA Change: T125A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000127995
Gene: ENSMUSG00000030528
AA Change: T125A

DomainStartEndE-ValueType
Pfam:BLM_N 4 375 1.1e-161 PFAM
Pfam:BDHCT 380 419 6.4e-25 PFAM
Pfam:BDHCT_assoc 433 658 8.8e-108 PFAM
DEXDc 675 876 1.59e-29 SMART
HELICc 913 995 1.29e-24 SMART
Pfam:RecQ_Zn_bind 1006 1078 1.5e-19 PFAM
RQC 1087 1201 1.43e-15 SMART
HRDC 1220 1300 9.4e-20 SMART
low complexity region 1360 1374 N/A INTRINSIC
low complexity region 1381 1395 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205263
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Bloom syndrome gene product is related to the RecQ subset of DExH box-containing DNA helicases and has both DNA-stimulated ATPase and ATP-dependent DNA helicase activities. Mutations causing Bloom syndrome delete or alter helicase motifs and may disable the 3'-5' helicase activity. The normal protein may act to suppress inappropriate recombination. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants are developmentally delayed, with increased apopotosis in the epiblast and severe anemia, dying at embyronic day 13.5; but homozygotes for a cre mediated recombinant allele are viable Bloom syndrome-like mice prone to a wide variety of cancers and showing increased rates of LOH. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy3 T A 12: 4,260,870 (GRCm39) N995K probably damaging Het
Aldh4a1 T C 4: 139,361,233 (GRCm39) M60T probably benign Het
Alpk2 A T 18: 65,505,809 (GRCm39) H70Q probably damaging Het
Babam2 T A 5: 31,859,207 (GRCm39) I5N possibly damaging Het
Bloc1s1 T C 10: 128,759,826 (GRCm39) probably benign Het
Calcr G T 6: 3,714,651 (GRCm39) Q160K probably benign Het
Ccdc43 C T 11: 102,581,058 (GRCm39) A131T probably damaging Het
Cdh15 A T 8: 123,591,839 (GRCm39) N575Y probably damaging Het
Chd8 T C 14: 52,441,611 (GRCm39) D827G probably damaging Het
Col3a1 A G 1: 45,387,059 (GRCm39) probably null Het
Creb5 A T 6: 53,658,002 (GRCm39) M255L possibly damaging Het
Cst8 A G 2: 148,646,503 (GRCm39) I78V probably benign Het
Cyld A G 8: 89,459,664 (GRCm39) E440G possibly damaging Het
Cyp2b9 A C 7: 25,887,167 (GRCm39) D192A probably damaging Het
Dclre1b C T 3: 103,711,290 (GRCm39) R207H probably damaging Het
Dnah6 A T 6: 73,100,838 (GRCm39) F1936L probably damaging Het
Dpp9 A C 17: 56,496,424 (GRCm39) Y761* probably null Het
Drc1 A T 5: 30,513,745 (GRCm39) M434L probably benign Het
Dtx3l A T 16: 35,753,397 (GRCm39) I403N probably damaging Het
Ecpas T A 4: 58,809,401 (GRCm39) K1658* probably null Het
Efcab9 A G 11: 32,477,484 (GRCm39) Y13H probably damaging Het
Efhb T A 17: 53,708,654 (GRCm39) N672I possibly damaging Het
Eif5b T C 1: 38,084,835 (GRCm39) V894A possibly damaging Het
Elovl3 T C 19: 46,123,135 (GRCm39) F237S probably benign Het
Emc1 T A 4: 139,093,802 (GRCm39) D637E probably damaging Het
Erbb2 C A 11: 98,324,238 (GRCm39) P742Q probably damaging Het
Fam234b C A 6: 135,210,355 (GRCm39) L584M probably damaging Het
Fancd2 A T 6: 113,545,673 (GRCm39) D14V possibly damaging Het
Fat2 T C 11: 55,153,646 (GRCm39) H3522R probably benign Het
Fgfr2 T C 7: 129,842,945 (GRCm39) N147D possibly damaging Het
Gm26657 A G 4: 56,741,180 (GRCm39) probably benign Het
Hcrtr1 C T 4: 130,029,518 (GRCm39) V188M probably benign Het
Herc1 T C 9: 66,375,169 (GRCm39) V3331A probably damaging Het
Hmcn2 T C 2: 31,320,453 (GRCm39) V3978A possibly damaging Het
Invs G A 4: 48,385,262 (GRCm39) R202K probably benign Het
Lgr5 C T 10: 115,314,469 (GRCm39) S156N probably benign Het
Mras T G 9: 99,276,669 (GRCm39) D67A probably damaging Het
Mrpl39 A G 16: 84,520,790 (GRCm39) L283P probably damaging Het
Ncoa6 A T 2: 155,275,915 (GRCm39) I110N probably benign Het
Neb T C 2: 52,102,596 (GRCm39) D544G possibly damaging Het
Nlrc3 A G 16: 3,782,617 (GRCm39) I264T possibly damaging Het
Or10a2 T A 7: 106,673,080 (GRCm39) M15K probably benign Het
Or1j13 A G 2: 36,369,309 (GRCm39) Y278H probably damaging Het
Or5k16 T C 16: 58,736,248 (GRCm39) Y252C possibly damaging Het
Or7g18 A G 9: 18,787,442 (GRCm39) K273R probably benign Het
Otx1 C A 11: 21,947,037 (GRCm39) A91S probably damaging Het
Phf11d T C 14: 59,590,120 (GRCm39) D234G probably null Het
Polq A T 16: 36,903,146 (GRCm39) D1980V probably damaging Het
Rasa1 A T 13: 85,437,022 (GRCm39) probably benign Het
Rufy4 T C 1: 74,186,822 (GRCm39) C537R probably damaging Het
Sec23a A G 12: 59,053,791 (GRCm39) V69A probably benign Het
Sipa1 A G 19: 5,709,640 (GRCm39) I260T probably damaging Het
Smarcc1 T A 9: 110,020,017 (GRCm39) L628H probably damaging Het
Snx31 A G 15: 36,525,730 (GRCm39) V323A probably damaging Het
Sun2 A G 15: 79,611,723 (GRCm39) S565P probably damaging Het
Tmem74 C T 15: 43,730,564 (GRCm39) D160N possibly damaging Het
Tnik T C 3: 28,648,241 (GRCm39) M431T probably benign Het
Trp53inp1 A G 4: 11,165,305 (GRCm39) T110A probably benign Het
Ttll9 G T 2: 152,826,144 (GRCm39) C118F probably benign Het
Vps4b A G 1: 106,719,422 (GRCm39) L42P probably benign Het
Xirp2 A T 2: 67,342,250 (GRCm39) N1497I probably damaging Het
Xpo4 A G 14: 57,875,764 (GRCm39) V123A probably damaging Het
Zfhx4 A T 3: 5,477,485 (GRCm39) T3367S probably damaging Het
Zfp236 T C 18: 82,615,813 (GRCm39) E1782G possibly damaging Het
Zfp35 T A 18: 24,135,973 (GRCm39) C106S possibly damaging Het
Zfpm1 A G 8: 123,062,812 (GRCm39) T624A probably benign Het
Zmiz2 C T 11: 6,347,519 (GRCm39) Q276* probably null Het
Other mutations in Blm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01531:Blm APN 7 80,123,819 (GRCm39) missense probably damaging 1.00
IGL01658:Blm APN 7 80,113,689 (GRCm39) missense probably damaging 0.98
IGL02048:Blm APN 7 80,152,709 (GRCm39) splice site probably benign
IGL02060:Blm APN 7 80,164,328 (GRCm39) splice site probably benign
IGL02063:Blm APN 7 80,159,167 (GRCm39) nonsense probably null
IGL02102:Blm APN 7 80,119,504 (GRCm39) missense probably damaging 1.00
IGL02420:Blm APN 7 80,145,754 (GRCm39) missense probably damaging 1.00
IGL02452:Blm APN 7 80,153,125 (GRCm39) splice site probably null
IGL02566:Blm APN 7 80,123,944 (GRCm39) missense probably damaging 1.00
IGL03387:Blm APN 7 80,143,895 (GRCm39) missense probably damaging 1.00
FR4304:Blm UTSW 7 80,162,667 (GRCm39) small insertion probably benign
FR4304:Blm UTSW 7 80,113,521 (GRCm39) frame shift probably null
FR4340:Blm UTSW 7 80,162,658 (GRCm39) small insertion probably benign
FR4340:Blm UTSW 7 80,162,655 (GRCm39) small insertion probably benign
FR4340:Blm UTSW 7 80,113,515 (GRCm39) unclassified probably benign
FR4449:Blm UTSW 7 80,162,656 (GRCm39) small insertion probably benign
FR4548:Blm UTSW 7 80,113,517 (GRCm39) frame shift probably null
FR4589:Blm UTSW 7 80,113,518 (GRCm39) frame shift probably null
FR4737:Blm UTSW 7 80,113,522 (GRCm39) frame shift probably null
FR4737:Blm UTSW 7 80,113,519 (GRCm39) frame shift probably null
FR4976:Blm UTSW 7 80,162,655 (GRCm39) small insertion probably benign
FR4976:Blm UTSW 7 80,113,515 (GRCm39) unclassified probably benign
R0133:Blm UTSW 7 80,152,115 (GRCm39) missense possibly damaging 0.93
R0194:Blm UTSW 7 80,114,694 (GRCm39) unclassified probably benign
R0526:Blm UTSW 7 80,155,641 (GRCm39) nonsense probably null
R0673:Blm UTSW 7 80,149,499 (GRCm39) critical splice donor site probably null
R0972:Blm UTSW 7 80,163,118 (GRCm39) missense probably benign
R0980:Blm UTSW 7 80,149,706 (GRCm39) splice site probably null
R1120:Blm UTSW 7 80,131,214 (GRCm39) missense probably damaging 1.00
R1301:Blm UTSW 7 80,105,165 (GRCm39) nonsense probably null
R1769:Blm UTSW 7 80,163,118 (GRCm39) missense probably benign
R1866:Blm UTSW 7 80,143,862 (GRCm39) missense probably benign 0.08
R1874:Blm UTSW 7 80,147,166 (GRCm39) missense probably damaging 1.00
R1966:Blm UTSW 7 80,162,934 (GRCm39) missense possibly damaging 0.86
R1991:Blm UTSW 7 80,155,697 (GRCm39) splice site probably null
R2013:Blm UTSW 7 80,152,147 (GRCm39) missense probably damaging 0.99
R2014:Blm UTSW 7 80,152,147 (GRCm39) missense probably damaging 0.99
R2015:Blm UTSW 7 80,152,147 (GRCm39) missense probably damaging 0.99
R2016:Blm UTSW 7 80,155,674 (GRCm39) missense probably benign 0.26
R2103:Blm UTSW 7 80,155,697 (GRCm39) splice site probably null
R2161:Blm UTSW 7 80,131,118 (GRCm39) splice site probably null
R2215:Blm UTSW 7 80,149,595 (GRCm39) missense possibly damaging 0.69
R3689:Blm UTSW 7 80,162,827 (GRCm39) missense possibly damaging 0.56
R4049:Blm UTSW 7 80,152,610 (GRCm39) missense probably benign 0.04
R4155:Blm UTSW 7 80,162,652 (GRCm39) small deletion probably benign
R4695:Blm UTSW 7 80,143,976 (GRCm39) missense probably damaging 1.00
R4774:Blm UTSW 7 80,113,596 (GRCm39) missense probably damaging 1.00
R4833:Blm UTSW 7 80,116,574 (GRCm39) missense probably benign
R4835:Blm UTSW 7 80,159,294 (GRCm39) missense probably benign 0.41
R4994:Blm UTSW 7 80,108,573 (GRCm39) missense probably benign 0.00
R5039:Blm UTSW 7 80,155,621 (GRCm39) missense possibly damaging 0.50
R5330:Blm UTSW 7 80,108,684 (GRCm39) missense possibly damaging 0.73
R5408:Blm UTSW 7 80,152,370 (GRCm39) missense probably benign 0.01
R5574:Blm UTSW 7 80,149,521 (GRCm39) missense probably damaging 1.00
R5606:Blm UTSW 7 80,110,580 (GRCm39) splice site probably null
R5702:Blm UTSW 7 80,108,675 (GRCm39) missense probably benign 0.13
R5809:Blm UTSW 7 80,114,592 (GRCm39) missense probably damaging 1.00
R6114:Blm UTSW 7 80,163,235 (GRCm39) missense probably damaging 1.00
R6157:Blm UTSW 7 80,162,733 (GRCm39) missense probably benign 0.18
R6163:Blm UTSW 7 80,162,652 (GRCm39) small deletion probably benign
R6254:Blm UTSW 7 80,130,090 (GRCm39) missense probably benign 0.04
R6266:Blm UTSW 7 80,149,688 (GRCm39) missense probably benign 0.03
R6364:Blm UTSW 7 80,144,274 (GRCm39) nonsense probably null
R6446:Blm UTSW 7 80,162,652 (GRCm39) small deletion probably benign
R6502:Blm UTSW 7 80,131,223 (GRCm39) missense probably damaging 0.98
R6700:Blm UTSW 7 80,113,598 (GRCm39) missense possibly damaging 0.91
R7002:Blm UTSW 7 80,119,501 (GRCm39) missense probably benign 0.00
R7105:Blm UTSW 7 80,149,516 (GRCm39) missense probably benign 0.44
R7320:Blm UTSW 7 80,105,102 (GRCm39) nonsense probably null
R7465:Blm UTSW 7 80,162,863 (GRCm39) missense probably benign 0.02
R7561:Blm UTSW 7 80,152,276 (GRCm39) missense probably damaging 0.99
R8500:Blm UTSW 7 80,105,032 (GRCm39) missense probably damaging 1.00
R8543:Blm UTSW 7 80,143,964 (GRCm39) missense probably damaging 0.98
R8774-TAIL:Blm UTSW 7 80,162,655 (GRCm39) small insertion probably benign
R8774-TAIL:Blm UTSW 7 80,162,666 (GRCm39) small insertion probably benign
R8774-TAIL:Blm UTSW 7 80,162,667 (GRCm39) small insertion probably benign
R8775-TAIL:Blm UTSW 7 80,162,679 (GRCm39) small insertion probably benign
R8860:Blm UTSW 7 80,144,276 (GRCm39) missense probably benign 0.30
R8928:Blm UTSW 7 80,162,652 (GRCm39) small deletion probably benign
R9089:Blm UTSW 7 80,162,867 (GRCm39) missense probably damaging 1.00
R9363:Blm UTSW 7 80,108,663 (GRCm39) missense probably damaging 1.00
RF001:Blm UTSW 7 80,162,675 (GRCm39) small insertion probably benign
RF001:Blm UTSW 7 80,162,654 (GRCm39) small insertion probably benign
RF001:Blm UTSW 7 80,162,651 (GRCm39) small insertion probably benign
RF002:Blm UTSW 7 80,162,675 (GRCm39) small insertion probably benign
RF002:Blm UTSW 7 80,162,653 (GRCm39) small insertion probably benign
RF007:Blm UTSW 7 80,162,681 (GRCm39) nonsense probably null
RF016:Blm UTSW 7 80,162,674 (GRCm39) nonsense probably null
RF018:Blm UTSW 7 80,162,674 (GRCm39) nonsense probably null
RF027:Blm UTSW 7 80,162,662 (GRCm39) frame shift probably null
RF028:Blm UTSW 7 80,162,653 (GRCm39) nonsense probably null
RF031:Blm UTSW 7 80,162,671 (GRCm39) small insertion probably benign
RF031:Blm UTSW 7 80,162,654 (GRCm39) small insertion probably benign
RF032:Blm UTSW 7 80,162,678 (GRCm39) small insertion probably benign
RF036:Blm UTSW 7 80,162,662 (GRCm39) nonsense probably null
RF044:Blm UTSW 7 80,162,678 (GRCm39) small insertion probably benign
RF053:Blm UTSW 7 80,162,669 (GRCm39) small insertion probably benign
RF064:Blm UTSW 7 80,162,671 (GRCm39) nonsense probably null
X0061:Blm UTSW 7 80,108,598 (GRCm39) missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- CTGAGCGGTGCTTACTCTTG -3'
(R):5'- CTGTCACTAGTGTGTCCGTAG -3'

Sequencing Primer
(F):5'- ACTCTTGTGGCAGGATTTTTAGCC -3'
(R):5'- GTGTGTCCGTAGTAAAAACACCTGC -3'
Posted On 2016-09-06