Incidental Mutation 'R5375:Cyld'
ID429015
Institutional Source Beutler Lab
Gene Symbol Cyld
Ensembl Gene ENSMUSG00000036712
Gene NameCYLD lysine 63 deubiquitinase
SynonymsCYLD1, C130039D01Rik, 2900009M21Rik, 2010013M14Rik
MMRRC Submission 042951-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5375 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location88697028-88751945 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 88733036 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 440 (E440G)
Ref Sequence ENSEMBL: ENSMUSP00000147904 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043526] [ENSMUST00000098519] [ENSMUST00000109626] [ENSMUST00000209206] [ENSMUST00000209532] [ENSMUST00000209559] [ENSMUST00000211554]
Predicted Effect probably benign
Transcript: ENSMUST00000043526
AA Change: E625G

PolyPhen 2 Score 0.104 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000039834
Gene: ENSMUSG00000036712
AA Change: E625G

DomainStartEndE-ValueType
low complexity region 109 120 N/A INTRINSIC
CAP_GLY 127 203 3.2e-18 SMART
CAP_GLY 232 303 5.37e-11 SMART
low complexity region 397 411 N/A INTRINSIC
CAP_GLY 471 539 2.68e-20 SMART
Pfam:UCH 591 891 1.7e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000098519
AA Change: E625G

PolyPhen 2 Score 0.336 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000096119
Gene: ENSMUSG00000036712
AA Change: E625G

DomainStartEndE-ValueType
low complexity region 109 120 N/A INTRINSIC
CAP_GLY 127 203 3.2e-18 SMART
CAP_GLY 232 303 5.37e-11 SMART
Pfam:CYLD_phos_site 307 470 6.5e-88 PFAM
CAP_GLY 471 539 2.68e-20 SMART
Pfam:UCH 590 893 2.1e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109626
AA Change: E622G

PolyPhen 2 Score 0.139 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000105254
Gene: ENSMUSG00000036712
AA Change: E622G

DomainStartEndE-ValueType
low complexity region 109 120 N/A INTRINSIC
CAP_GLY 127 203 3.2e-18 SMART
CAP_GLY 232 303 5.37e-11 SMART
Pfam:CYLD_phos_site 304 467 2.5e-88 PFAM
CAP_GLY 468 536 2.68e-20 SMART
Pfam:UCH 587 890 2e-14 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000209206
AA Change: E440G

PolyPhen 2 Score 0.768 (Sensitivity: 0.85; Specificity: 0.92)
Predicted Effect probably benign
Transcript: ENSMUST00000209532
AA Change: E625G

PolyPhen 2 Score 0.336 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000209559
AA Change: E622G

PolyPhen 2 Score 0.139 (Sensitivity: 0.92; Specificity: 0.86)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209722
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210302
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211038
Predicted Effect probably benign
Transcript: ENSMUST00000211554
AA Change: E622G

PolyPhen 2 Score 0.139 (Sensitivity: 0.92; Specificity: 0.86)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211671
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a protein that is a member of the ubiquitin C-terminal hydrolase subfamily of the deubiquitinating enzyme family. Members of this family catalyze the removal of ubiquitin from a substrate or another ubiquitin molecule and thereby play important roles in regulating signaling pathways, recycling ubiquitin and regulating protein stability. This protein removes ubiquitin from K-63-linked ubiquitin chains from proteins involved in NF-kappaB signaling and thus acts as a negative regulator of this pathway. In humans mutations in this gene have been associated with cylindromatosis, an autosomal dominant predisposition to tumors of skin appendages. In mouse deficiency of this gene impairs thymocyte development and increases susceptibility to skin and colon tumors. A pseudogene of this gene has been identified on chromosome 1. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Jan 2013]
PHENOTYPE: Various knockout models with different exon deletions have been created. Observed phenotypes include altered T cell and B cell development, susceptibility to induced skin tumors, resistance to lethal lung infection, high colon tumor incidence, kinky tails, and neonatal death due to lung dysfunction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy3 T A 12: 4,210,870 N995K probably damaging Het
AI314180 T A 4: 58,809,401 K1658* probably null Het
Aldh4a1 T C 4: 139,633,922 M60T probably benign Het
Alpk2 A T 18: 65,372,738 H70Q probably damaging Het
Babam2 T A 5: 31,701,863 I5N possibly damaging Het
Blm T C 7: 80,513,229 T125A probably benign Het
Bloc1s1 T C 10: 128,923,957 probably benign Het
Calcr G T 6: 3,714,651 Q160K probably benign Het
Ccdc43 C T 11: 102,690,232 A131T probably damaging Het
Cdh15 A T 8: 122,865,100 N575Y probably damaging Het
Chd8 T C 14: 52,204,154 D827G probably damaging Het
Col3a1 A G 1: 45,347,899 probably null Het
Creb5 A T 6: 53,681,017 M255L possibly damaging Het
Cst8 A G 2: 148,804,583 I78V probably benign Het
Cyp2b9 A C 7: 26,187,742 D192A probably damaging Het
Dclre1b C T 3: 103,803,974 R207H probably damaging Het
Dnah6 A T 6: 73,123,855 F1936L probably damaging Het
Dpp9 A C 17: 56,189,424 Y761* probably null Het
Drc1 A T 5: 30,356,401 M434L probably benign Het
Dtx3l A T 16: 35,933,027 I403N probably damaging Het
Efcab9 A G 11: 32,527,484 Y13H probably damaging Het
Efhb T A 17: 53,401,626 N672I possibly damaging Het
Eif5b T C 1: 38,045,754 V894A possibly damaging Het
Elovl3 T C 19: 46,134,696 F237S probably benign Het
Emc1 T A 4: 139,366,491 D637E probably damaging Het
Erbb2 C A 11: 98,433,412 P742Q probably damaging Het
Fam234b C A 6: 135,233,357 L584M probably damaging Het
Fancd2 A T 6: 113,568,712 D14V possibly damaging Het
Fat2 T C 11: 55,262,820 H3522R probably benign Het
Fgfr2 T C 7: 130,241,215 N147D possibly damaging Het
Gm26657 A G 4: 56,741,180 probably benign Het
Hcrtr1 C T 4: 130,135,725 V188M probably benign Het
Herc1 T C 9: 66,467,887 V3331A probably damaging Het
Hmcn2 T C 2: 31,430,441 V3978A possibly damaging Het
Invs G A 4: 48,385,262 R202K probably benign Het
Lgr5 C T 10: 115,478,564 S156N probably benign Het
Mras T G 9: 99,394,616 D67A probably damaging Het
Mrpl39 A G 16: 84,723,902 L283P probably damaging Het
Ncoa6 A T 2: 155,433,995 I110N probably benign Het
Neb T C 2: 52,212,584 D544G possibly damaging Het
Nlrc3 A G 16: 3,964,753 I264T possibly damaging Het
Olfr180 T C 16: 58,915,885 Y252C possibly damaging Het
Olfr341 A G 2: 36,479,297 Y278H probably damaging Het
Olfr714 T A 7: 107,073,873 M15K probably benign Het
Olfr830 A G 9: 18,876,146 K273R probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Phf11d T C 14: 59,352,671 D234G probably null Het
Polq A T 16: 37,082,784 D1980V probably damaging Het
Rasa1 A T 13: 85,288,903 probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sec23a A G 12: 59,007,005 V69A probably benign Het
Sipa1 A G 19: 5,659,612 I260T probably damaging Het
Smarcc1 T A 9: 110,190,949 L628H probably damaging Het
Snx31 A G 15: 36,525,584 V323A probably damaging Het
Sun2 A G 15: 79,727,522 S565P probably damaging Het
Tmem74 C T 15: 43,867,168 D160N possibly damaging Het
Tnik T C 3: 28,594,092 M431T probably benign Het
Trp53inp1 A G 4: 11,165,305 T110A probably benign Het
Ttll9 G T 2: 152,984,224 C118F probably benign Het
Vps4b A G 1: 106,791,692 L42P probably benign Het
Xirp2 A T 2: 67,511,906 N1497I probably damaging Het
Xpo4 A G 14: 57,638,307 V123A probably damaging Het
Zfhx4 A T 3: 5,412,425 T3367S probably damaging Het
Zfp236 T C 18: 82,597,688 E1782G possibly damaging Het
Zfp35 T A 18: 24,002,916 C106S possibly damaging Het
Zfpm1 A G 8: 122,336,073 T624A probably benign Het
Zmiz2 C T 11: 6,397,519 Q276* probably null Het
Other mutations in Cyld
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Cyld APN 8 88705457 missense probably benign 0.41
IGL00481:Cyld APN 8 88707290 missense probably damaging 1.00
IGL01013:Cyld APN 8 88742362 missense probably damaging 1.00
IGL01653:Cyld APN 8 88741370 missense probably damaging 1.00
IGL01700:Cyld APN 8 88707099 missense probably damaging 0.99
IGL01845:Cyld APN 8 88705775 nonsense probably null
IGL02366:Cyld APN 8 88729753 missense probably damaging 1.00
IGL02379:Cyld APN 8 88744928 nonsense probably null
IGL02506:Cyld APN 8 88729590 missense possibly damaging 0.86
IGL02563:Cyld APN 8 88735894 missense probably damaging 1.00
IGL02565:Cyld APN 8 88741291 missense probably damaging 1.00
IGL02814:Cyld APN 8 88744897 missense probably benign 0.29
PIT4131001:Cyld UTSW 8 88746915 missense probably damaging 0.98
R0101:Cyld UTSW 8 88718300 critical splice donor site probably null
R0122:Cyld UTSW 8 88742292 missense probably damaging 1.00
R0529:Cyld UTSW 8 88729759 missense probably benign 0.34
R0838:Cyld UTSW 8 88741350 missense probably benign 0.15
R1589:Cyld UTSW 8 88709990 missense possibly damaging 0.84
R1732:Cyld UTSW 8 88731667 splice site probably benign
R2029:Cyld UTSW 8 88745312 missense probably benign 0.09
R3701:Cyld UTSW 8 88729551 missense probably benign
R3798:Cyld UTSW 8 88734930 missense probably damaging 1.00
R4243:Cyld UTSW 8 88730755 nonsense probably null
R4244:Cyld UTSW 8 88730755 nonsense probably null
R4260:Cyld UTSW 8 88741391 missense probably damaging 1.00
R4458:Cyld UTSW 8 88719301 missense probably benign 0.24
R4551:Cyld UTSW 8 88707134 missense possibly damaging 0.95
R4718:Cyld UTSW 8 88742305 missense probably damaging 0.99
R4735:Cyld UTSW 8 88729650 missense probably damaging 1.00
R4753:Cyld UTSW 8 88744816 splice site probably null
R4966:Cyld UTSW 8 88742301 missense possibly damaging 0.55
R4975:Cyld UTSW 8 88707232 missense probably benign
R5647:Cyld UTSW 8 88734926 missense probably benign 0.10
R5741:Cyld UTSW 8 88744846 missense probably damaging 1.00
R5837:Cyld UTSW 8 88741404 missense probably damaging 0.99
R5931:Cyld UTSW 8 88729842 splice site probably null
R5970:Cyld UTSW 8 88732993 missense probably damaging 0.99
R5992:Cyld UTSW 8 88733053 missense probably damaging 1.00
R6165:Cyld UTSW 8 88746933 missense possibly damaging 0.88
R7135:Cyld UTSW 8 88744892 missense possibly damaging 0.93
X0010:Cyld UTSW 8 88746912 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGCTGTCTTGACACATGAATTC -3'
(R):5'- ACACCTCATCTGCTTTTAGTACAGTG -3'

Sequencing Primer
(F):5'- GACACATGAATTCTTATGCATTGCTC -3'
(R):5'- CACTGAAATAAACAGAAGCAGAAGAC -3'
Posted On2016-09-06