Incidental Mutation 'R5375:Lgr5'
ID429022
Institutional Source Beutler Lab
Gene Symbol Lgr5
Ensembl Gene ENSMUSG00000020140
Gene Nameleucine rich repeat containing G protein coupled receptor 5
SynonymsGpr49
MMRRC Submission 042951-MU
Accession Numbers

Ncbi RefSeq: NM_010195.2; MGI: 1341817

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5375 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location115450311-115587780 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 115478564 bp
ZygosityHeterozygous
Amino Acid Change Serine to Asparagine at position 156 (S156N)
Ref Sequence ENSEMBL: ENSMUSP00000020350 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020350] [ENSMUST00000172806] [ENSMUST00000173740]
Predicted Effect probably benign
Transcript: ENSMUST00000020350
AA Change: S156N

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000020350
Gene: ENSMUSG00000020140
AA Change: S156N

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
LRRNT 33 70 1.43e-5 SMART
LRR 64 88 1.41e2 SMART
LRR_TYP 89 112 3.44e-4 SMART
LRR_TYP 113 136 9.88e-5 SMART
LRR_TYP 137 160 9.73e-4 SMART
LRR_TYP 161 184 5.21e-4 SMART
LRR 185 208 6.22e0 SMART
LRR_TYP 209 232 3.89e-3 SMART
LRR 233 255 9.75e0 SMART
LRR_TYP 256 279 1.38e-3 SMART
Blast:LRR 281 303 2e-6 BLAST
Blast:LRR 304 328 1e-5 BLAST
LRR_TYP 351 374 1.56e-2 SMART
LRR 375 396 1.09e2 SMART
LRR_TYP 397 420 7.26e-3 SMART
LRR 421 444 2.86e-1 SMART
low complexity region 518 533 N/A INTRINSIC
Pfam:7tm_1 574 820 9.5e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000105272
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149008
Predicted Effect probably benign
Transcript: ENSMUST00000172806
AA Change: S156N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000133860
Gene: ENSMUSG00000020140
AA Change: S156N

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
LRRNT 33 70 1.43e-5 SMART
LRR 64 88 1.41e2 SMART
LRR_TYP 89 112 3.44e-4 SMART
LRR_TYP 113 136 9.88e-5 SMART
LRR_TYP 137 160 9.73e-4 SMART
LRR_TYP 161 184 5.21e-4 SMART
LRR 185 208 6.22e0 SMART
LRR_TYP 209 232 3.89e-3 SMART
LRR 233 255 9.75e0 SMART
LRR 256 279 6.57e-1 SMART
Blast:LRR 280 304 1e-5 BLAST
LRR_TYP 327 350 1.56e-2 SMART
LRR 351 372 1.09e2 SMART
LRR_TYP 373 396 7.26e-3 SMART
LRR 397 420 2.86e-1 SMART
low complexity region 494 509 N/A INTRINSIC
Pfam:7tm_1 550 796 8.2e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173740
SMART Domains Protein: ENSMUSP00000133707
Gene: ENSMUSG00000020140

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
LRRNT 33 70 1.43e-5 SMART
LRR 64 88 1.41e2 SMART
LRR_TYP 89 112 3.44e-4 SMART
LRR_TYP 113 136 9.88e-5 SMART
LRR_TYP 137 160 9.08e-4 SMART
LRR 161 183 9.75e0 SMART
LRR_TYP 184 207 1.38e-3 SMART
Blast:LRR 209 231 1e-6 BLAST
Blast:LRR 232 256 1e-5 BLAST
LRR_TYP 279 302 1.56e-2 SMART
LRR 303 324 1.09e2 SMART
LRR_TYP 325 348 7.26e-3 SMART
LRR 349 372 2.86e-1 SMART
low complexity region 446 461 N/A INTRINSIC
Pfam:7tm_1 502 748 7.4e-16 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype Strain: 3512420
Lethality: D1-D2
FUNCTION: The protein encoded by this gene is a leucine-rich repeat-containing receptor (LGR) and member of the G protein-coupled, 7-transmembrane receptor (GPCR) superfamily. The encoded protein is a receptor for R-spondins and is involved in the canonical Wnt signaling pathway. This protein plays a role in the formation and maintenance of adult intestinal stem cells during postembryonic development. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a knock-out allele display 100% neonatal lethality associated with ankyloglossia, gastrointestinal distension, cyanosis and respiratory failure. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted(7)

Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy3 T A 12: 4,210,870 N995K probably damaging Het
AI314180 T A 4: 58,809,401 K1658* probably null Het
Aldh4a1 T C 4: 139,633,922 M60T probably benign Het
Alpk2 A T 18: 65,372,738 H70Q probably damaging Het
Babam2 T A 5: 31,701,863 I5N possibly damaging Het
Blm T C 7: 80,513,229 T125A probably benign Het
Bloc1s1 T C 10: 128,923,957 probably benign Het
Calcr G T 6: 3,714,651 Q160K probably benign Het
Ccdc43 C T 11: 102,690,232 A131T probably damaging Het
Cdh15 A T 8: 122,865,100 N575Y probably damaging Het
Chd8 T C 14: 52,204,154 D827G probably damaging Het
Col3a1 A G 1: 45,347,899 probably null Het
Creb5 A T 6: 53,681,017 M255L possibly damaging Het
Cst8 A G 2: 148,804,583 I78V probably benign Het
Cyld A G 8: 88,733,036 E440G possibly damaging Het
Cyp2b9 A C 7: 26,187,742 D192A probably damaging Het
Dclre1b C T 3: 103,803,974 R207H probably damaging Het
Dnah6 A T 6: 73,123,855 F1936L probably damaging Het
Dpp9 A C 17: 56,189,424 Y761* probably null Het
Drc1 A T 5: 30,356,401 M434L probably benign Het
Dtx3l A T 16: 35,933,027 I403N probably damaging Het
Efcab9 A G 11: 32,527,484 Y13H probably damaging Het
Efhb T A 17: 53,401,626 N672I possibly damaging Het
Eif5b T C 1: 38,045,754 V894A possibly damaging Het
Elovl3 T C 19: 46,134,696 F237S probably benign Het
Emc1 T A 4: 139,366,491 D637E probably damaging Het
Erbb2 C A 11: 98,433,412 P742Q probably damaging Het
Fam234b C A 6: 135,233,357 L584M probably damaging Het
Fancd2 A T 6: 113,568,712 D14V possibly damaging Het
Fat2 T C 11: 55,262,820 H3522R probably benign Het
Fgfr2 T C 7: 130,241,215 N147D possibly damaging Het
Gm26657 A G 4: 56,741,180 probably benign Het
Hcrtr1 C T 4: 130,135,725 V188M probably benign Het
Herc1 T C 9: 66,467,887 V3331A probably damaging Het
Hmcn2 T C 2: 31,430,441 V3978A possibly damaging Het
Invs G A 4: 48,385,262 R202K probably benign Het
Mras T G 9: 99,394,616 D67A probably damaging Het
Mrpl39 A G 16: 84,723,902 L283P probably damaging Het
Ncoa6 A T 2: 155,433,995 I110N probably benign Het
Neb T C 2: 52,212,584 D544G possibly damaging Het
Nlrc3 A G 16: 3,964,753 I264T possibly damaging Het
Olfr180 T C 16: 58,915,885 Y252C possibly damaging Het
Olfr341 A G 2: 36,479,297 Y278H probably damaging Het
Olfr714 T A 7: 107,073,873 M15K probably benign Het
Olfr830 A G 9: 18,876,146 K273R probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Phf11d T C 14: 59,352,671 D234G probably null Het
Polq A T 16: 37,082,784 D1980V probably damaging Het
Rasa1 A T 13: 85,288,903 probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sec23a A G 12: 59,007,005 V69A probably benign Het
Sipa1 A G 19: 5,659,612 I260T probably damaging Het
Smarcc1 T A 9: 110,190,949 L628H probably damaging Het
Snx31 A G 15: 36,525,584 V323A probably damaging Het
Sun2 A G 15: 79,727,522 S565P probably damaging Het
Tmem74 C T 15: 43,867,168 D160N possibly damaging Het
Tnik T C 3: 28,594,092 M431T probably benign Het
Trp53inp1 A G 4: 11,165,305 T110A probably benign Het
Ttll9 G T 2: 152,984,224 C118F probably benign Het
Vps4b A G 1: 106,791,692 L42P probably benign Het
Xirp2 A T 2: 67,511,906 N1497I probably damaging Het
Xpo4 A G 14: 57,638,307 V123A probably damaging Het
Zfhx4 A T 3: 5,412,425 T3367S probably damaging Het
Zfp236 T C 18: 82,597,688 E1782G possibly damaging Het
Zfp35 T A 18: 24,002,916 C106S possibly damaging Het
Zfpm1 A G 8: 122,336,073 T624A probably benign Het
Zmiz2 C T 11: 6,397,519 Q276* probably null Het
Other mutations in Lgr5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00341:Lgr5 APN 10 115454464 missense possibly damaging 0.69
IGL01291:Lgr5 APN 10 115478534 missense probably damaging 1.00
IGL01432:Lgr5 APN 10 115453092 missense probably damaging 1.00
IGL01778:Lgr5 APN 10 115462702 missense probably damaging 0.97
IGL01936:Lgr5 APN 10 115452414 missense probably damaging 1.00
IGL02079:Lgr5 APN 10 115452194 missense probably damaging 1.00
IGL02134:Lgr5 APN 10 115452858 missense possibly damaging 0.89
IGL03083:Lgr5 APN 10 115453032 missense probably benign 0.26
IGL03350:Lgr5 APN 10 115471988 missense probably damaging 0.99
anger UTSW 10 115466346 missense probably benign 0.03
ANU05:Lgr5 UTSW 10 115478534 missense probably damaging 1.00
R0378:Lgr5 UTSW 10 115454499 missense probably damaging 1.00
R0788:Lgr5 UTSW 10 115452997 missense probably damaging 0.99
R1119:Lgr5 UTSW 10 115460811 critical splice donor site probably null
R1321:Lgr5 UTSW 10 115478457 missense probably damaging 1.00
R1880:Lgr5 UTSW 10 115452279 missense probably damaging 1.00
R1985:Lgr5 UTSW 10 115495245 splice site probably benign
R2434:Lgr5 UTSW 10 115587406 missense probably benign
R3055:Lgr5 UTSW 10 115466123 splice site probably benign
R3910:Lgr5 UTSW 10 115587463 missense possibly damaging 0.93
R4686:Lgr5 UTSW 10 115458743 intron probably benign
R4862:Lgr5 UTSW 10 115462764 missense probably damaging 1.00
R4866:Lgr5 UTSW 10 115452685 missense probably benign 0.00
R5089:Lgr5 UTSW 10 115478423 missense probably damaging 1.00
R5118:Lgr5 UTSW 10 115452339 missense possibly damaging 0.88
R5537:Lgr5 UTSW 10 115456689 missense probably benign 0.00
R5583:Lgr5 UTSW 10 115478504 missense probably benign 0.32
R6312:Lgr5 UTSW 10 115452924 missense probably damaging 1.00
R6362:Lgr5 UTSW 10 115478525 missense probably damaging 1.00
R6605:Lgr5 UTSW 10 115457867 missense possibly damaging 0.69
R6689:Lgr5 UTSW 10 115466608 missense probably damaging 0.99
R6705:Lgr5 UTSW 10 115587288 missense probably damaging 0.96
R6925:Lgr5 UTSW 10 115466346 missense probably benign 0.03
R7063:Lgr5 UTSW 10 115456734 missense probably damaging 1.00
R7261:Lgr5 UTSW 10 115587465 missense possibly damaging 0.96
R7274:Lgr5 UTSW 10 115452505 missense probably damaging 0.99
R7458:Lgr5 UTSW 10 115457755 critical splice donor site probably null
R7569:Lgr5 UTSW 10 115462756 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTGAAGGCTAAGATCTCAGAGGG -3'
(R):5'- GAAAACCCGTCCCAGTTTGTC -3'

Sequencing Primer
(F):5'- CTTACAGAACCACGAGGCTGG -3'
(R):5'- CTGGGGCCTGGAGCTTGAC -3'
Posted On2016-09-06