Incidental Mutation 'R5375:Bloc1s1'
ID429023
Institutional Source Beutler Lab
Gene Symbol Bloc1s1
Ensembl Gene ENSMUSG00000090247
Gene Namebiogenesis of lysosomal organelles complex-1, subunit 1
SynonymsBLOS1, Gcn5l1
MMRRC Submission 042951-MU
Accession Numbers
Is this an essential gene? Not available question?
Stock #R5375 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location128917882-128924035 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 128923957 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000117408 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026405] [ENSMUST00000026406] [ENSMUST00000131271] [ENSMUST00000135161] [ENSMUST00000149961] [ENSMUST00000153731]
Predicted Effect probably benign
Transcript: ENSMUST00000026405
SMART Domains Protein: ENSMUSP00000026405
Gene: ENSMUSG00000090247

DomainStartEndE-ValueType
Pfam:GCN5L1 5 125 3.1e-56 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000026406
SMART Domains Protein: ENSMUSP00000026406
Gene: ENSMUSG00000025350

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:adh_short 29 194 3.6e-23 PFAM
Pfam:adh_short_C2 35 230 6.6e-10 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000131271
AA Change: H7R
SMART Domains Protein: ENSMUSP00000114321
Gene: ENSMUSG00000090247
AA Change: H7R

DomainStartEndE-ValueType
Pfam:GCN5L1 4 121 1.7e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135161
SMART Domains Protein: ENSMUSP00000115182
Gene: ENSMUSG00000025350

DomainStartEndE-ValueType
transmembrane domain 59 78 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141320
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143628
Predicted Effect probably benign
Transcript: ENSMUST00000149961
SMART Domains Protein: ENSMUSP00000123183
Gene: ENSMUSG00000025350

DomainStartEndE-ValueType
Pfam:adh_short 2 124 4e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153731
SMART Domains Protein: ENSMUSP00000117408
Gene: ENSMUSG00000090247

DomainStartEndE-ValueType
Pfam:GCN5L1 5 92 1.6e-38 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153935
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] BLOC1S1 is a component of the ubiquitously expressed BLOC1 multisubunit protein complex. BLOC1 is required for normal biogenesis of specialized organelles of the endosomal-lysosomal system, such as melanosomes and platelet dense granules (Starcevic and Dell'Angelica, 2004 [PubMed 15102850]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygous inactivation of this gene leads to embryonic lethality. Mouse embryonic fibroblasts show alterations in autophagy, mitochondrial physiology, and vesicle-mediated transport. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy3 T A 12: 4,210,870 N995K probably damaging Het
AI314180 T A 4: 58,809,401 K1658* probably null Het
Aldh4a1 T C 4: 139,633,922 M60T probably benign Het
Alpk2 A T 18: 65,372,738 H70Q probably damaging Het
Babam2 T A 5: 31,701,863 I5N possibly damaging Het
Blm T C 7: 80,513,229 T125A probably benign Het
Calcr G T 6: 3,714,651 Q160K probably benign Het
Ccdc43 C T 11: 102,690,232 A131T probably damaging Het
Cdh15 A T 8: 122,865,100 N575Y probably damaging Het
Chd8 T C 14: 52,204,154 D827G probably damaging Het
Col3a1 A G 1: 45,347,899 probably null Het
Creb5 A T 6: 53,681,017 M255L possibly damaging Het
Cst8 A G 2: 148,804,583 I78V probably benign Het
Cyld A G 8: 88,733,036 E440G possibly damaging Het
Cyp2b9 A C 7: 26,187,742 D192A probably damaging Het
Dclre1b C T 3: 103,803,974 R207H probably damaging Het
Dnah6 A T 6: 73,123,855 F1936L probably damaging Het
Dpp9 A C 17: 56,189,424 Y761* probably null Het
Drc1 A T 5: 30,356,401 M434L probably benign Het
Dtx3l A T 16: 35,933,027 I403N probably damaging Het
Efcab9 A G 11: 32,527,484 Y13H probably damaging Het
Efhb T A 17: 53,401,626 N672I possibly damaging Het
Eif5b T C 1: 38,045,754 V894A possibly damaging Het
Elovl3 T C 19: 46,134,696 F237S probably benign Het
Emc1 T A 4: 139,366,491 D637E probably damaging Het
Erbb2 C A 11: 98,433,412 P742Q probably damaging Het
Fam234b C A 6: 135,233,357 L584M probably damaging Het
Fancd2 A T 6: 113,568,712 D14V possibly damaging Het
Fat2 T C 11: 55,262,820 H3522R probably benign Het
Fgfr2 T C 7: 130,241,215 N147D possibly damaging Het
Gm26657 A G 4: 56,741,180 probably benign Het
Hcrtr1 C T 4: 130,135,725 V188M probably benign Het
Herc1 T C 9: 66,467,887 V3331A probably damaging Het
Hmcn2 T C 2: 31,430,441 V3978A possibly damaging Het
Invs G A 4: 48,385,262 R202K probably benign Het
Lgr5 C T 10: 115,478,564 S156N probably benign Het
Mras T G 9: 99,394,616 D67A probably damaging Het
Mrpl39 A G 16: 84,723,902 L283P probably damaging Het
Ncoa6 A T 2: 155,433,995 I110N probably benign Het
Neb T C 2: 52,212,584 D544G possibly damaging Het
Nlrc3 A G 16: 3,964,753 I264T possibly damaging Het
Olfr180 T C 16: 58,915,885 Y252C possibly damaging Het
Olfr341 A G 2: 36,479,297 Y278H probably damaging Het
Olfr714 T A 7: 107,073,873 M15K probably benign Het
Olfr830 A G 9: 18,876,146 K273R probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Phf11d T C 14: 59,352,671 D234G probably null Het
Polq A T 16: 37,082,784 D1980V probably damaging Het
Rasa1 A T 13: 85,288,903 probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sec23a A G 12: 59,007,005 V69A probably benign Het
Sipa1 A G 19: 5,659,612 I260T probably damaging Het
Smarcc1 T A 9: 110,190,949 L628H probably damaging Het
Snx31 A G 15: 36,525,584 V323A probably damaging Het
Sun2 A G 15: 79,727,522 S565P probably damaging Het
Tmem74 C T 15: 43,867,168 D160N possibly damaging Het
Tnik T C 3: 28,594,092 M431T probably benign Het
Trp53inp1 A G 4: 11,165,305 T110A probably benign Het
Ttll9 G T 2: 152,984,224 C118F probably benign Het
Vps4b A G 1: 106,791,692 L42P probably benign Het
Xirp2 A T 2: 67,511,906 N1497I probably damaging Het
Xpo4 A G 14: 57,638,307 V123A probably damaging Het
Zfhx4 A T 3: 5,412,425 T3367S probably damaging Het
Zfp236 T C 18: 82,597,688 E1782G possibly damaging Het
Zfp35 T A 18: 24,002,916 C106S possibly damaging Het
Zfpm1 A G 8: 122,336,073 T624A probably benign Het
Zmiz2 C T 11: 6,397,519 Q276* probably null Het
Other mutations in Bloc1s1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02137:Bloc1s1 APN 10 128922648 splice site probably benign
R4702:Bloc1s1 UTSW 10 128923398 missense probably damaging 1.00
R5987:Bloc1s1 UTSW 10 128923386 missense probably damaging 1.00
R7108:Bloc1s1 UTSW 10 128922723 missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- GTGTCCTGATGCTGTCCACTAC -3'
(R):5'- CCTTAGTCGGAGAAGCACTG -3'

Sequencing Primer
(F):5'- ACTACACTTCTGTTACTAGGGTAGC -3'
(R):5'- GTCGGAGAAGCACTGTATAATTTACC -3'
Posted On2016-09-06