Incidental Mutation 'R5375:Polq'
ID429042
Institutional Source Beutler Lab
Gene Symbol Polq
Ensembl Gene ENSMUSG00000034206
Gene Namepolymerase (DNA directed), theta
SynonymsA430110D14Rik
MMRRC Submission 042951-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.322) question?
Stock #R5375 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location37011786-37095417 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 37082784 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 1980 (D1980V)
Ref Sequence ENSEMBL: ENSMUSP00000071396 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054034] [ENSMUST00000071452] [ENSMUST00000182946] [ENSMUST00000183112]
Predicted Effect probably damaging
Transcript: ENSMUST00000054034
AA Change: D2259V

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000059757
Gene: ENSMUSG00000034206
AA Change: D2259V

DomainStartEndE-ValueType
low complexity region 2 29 N/A INTRINSIC
low complexity region 38 55 N/A INTRINSIC
DEXDc 87 298 4.09e-18 SMART
HELICc 398 484 4.02e-17 SMART
Blast:DEXDc 485 550 2e-25 BLAST
low complexity region 609 626 N/A INTRINSIC
PDB:2ZJA|A 712 826 5e-9 PDB
low complexity region 845 852 N/A INTRINSIC
low complexity region 898 911 N/A INTRINSIC
low complexity region 1126 1149 N/A INTRINSIC
low complexity region 1813 1822 N/A INTRINSIC
POLAc 2265 2504 3.3e-101 SMART
low complexity region 2521 2531 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000071452
AA Change: D1980V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000071396
Gene: ENSMUSG00000034206
AA Change: D1980V

DomainStartEndE-ValueType
low complexity region 2 29 N/A INTRINSIC
low complexity region 38 55 N/A INTRINSIC
Pfam:DEAD 92 216 5.9e-12 PFAM
low complexity region 330 347 N/A INTRINSIC
PDB:2ZJA|A 433 547 5e-9 PDB
low complexity region 566 573 N/A INTRINSIC
low complexity region 619 632 N/A INTRINSIC
low complexity region 847 870 N/A INTRINSIC
low complexity region 1534 1543 N/A INTRINSIC
POLAc 1986 2225 3.3e-101 SMART
low complexity region 2242 2252 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182717
Predicted Effect probably benign
Transcript: ENSMUST00000182946
SMART Domains Protein: ENSMUSP00000138685
Gene: ENSMUSG00000034206

DomainStartEndE-ValueType
low complexity region 2 29 N/A INTRINSIC
low complexity region 38 55 N/A INTRINSIC
Pfam:DEAD 92 164 1.3e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000183112
SMART Domains Protein: ENSMUSP00000138648
Gene: ENSMUSG00000034206

DomainStartEndE-ValueType
low complexity region 2 29 N/A INTRINSIC
low complexity region 38 55 N/A INTRINSIC
Pfam:DEAD 92 164 1.3e-9 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Animals carrying a homozygous mutation at this locus display elevated levels of chromosomal damage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy3 T A 12: 4,210,870 N995K probably damaging Het
AI314180 T A 4: 58,809,401 K1658* probably null Het
Aldh4a1 T C 4: 139,633,922 M60T probably benign Het
Alpk2 A T 18: 65,372,738 H70Q probably damaging Het
Babam2 T A 5: 31,701,863 I5N possibly damaging Het
Blm T C 7: 80,513,229 T125A probably benign Het
Bloc1s1 T C 10: 128,923,957 probably benign Het
Calcr G T 6: 3,714,651 Q160K probably benign Het
Ccdc43 C T 11: 102,690,232 A131T probably damaging Het
Cdh15 A T 8: 122,865,100 N575Y probably damaging Het
Chd8 T C 14: 52,204,154 D827G probably damaging Het
Col3a1 A G 1: 45,347,899 probably null Het
Creb5 A T 6: 53,681,017 M255L possibly damaging Het
Cst8 A G 2: 148,804,583 I78V probably benign Het
Cyld A G 8: 88,733,036 E440G possibly damaging Het
Cyp2b9 A C 7: 26,187,742 D192A probably damaging Het
Dclre1b C T 3: 103,803,974 R207H probably damaging Het
Dnah6 A T 6: 73,123,855 F1936L probably damaging Het
Dpp9 A C 17: 56,189,424 Y761* probably null Het
Drc1 A T 5: 30,356,401 M434L probably benign Het
Dtx3l A T 16: 35,933,027 I403N probably damaging Het
Efcab9 A G 11: 32,527,484 Y13H probably damaging Het
Efhb T A 17: 53,401,626 N672I possibly damaging Het
Eif5b T C 1: 38,045,754 V894A possibly damaging Het
Elovl3 T C 19: 46,134,696 F237S probably benign Het
Emc1 T A 4: 139,366,491 D637E probably damaging Het
Erbb2 C A 11: 98,433,412 P742Q probably damaging Het
Fam234b C A 6: 135,233,357 L584M probably damaging Het
Fancd2 A T 6: 113,568,712 D14V possibly damaging Het
Fat2 T C 11: 55,262,820 H3522R probably benign Het
Fgfr2 T C 7: 130,241,215 N147D possibly damaging Het
Gm26657 A G 4: 56,741,180 probably benign Het
Hcrtr1 C T 4: 130,135,725 V188M probably benign Het
Herc1 T C 9: 66,467,887 V3331A probably damaging Het
Hmcn2 T C 2: 31,430,441 V3978A possibly damaging Het
Invs G A 4: 48,385,262 R202K probably benign Het
Lgr5 C T 10: 115,478,564 S156N probably benign Het
Mras T G 9: 99,394,616 D67A probably damaging Het
Mrpl39 A G 16: 84,723,902 L283P probably damaging Het
Ncoa6 A T 2: 155,433,995 I110N probably benign Het
Neb T C 2: 52,212,584 D544G possibly damaging Het
Nlrc3 A G 16: 3,964,753 I264T possibly damaging Het
Olfr180 T C 16: 58,915,885 Y252C possibly damaging Het
Olfr341 A G 2: 36,479,297 Y278H probably damaging Het
Olfr714 T A 7: 107,073,873 M15K probably benign Het
Olfr830 A G 9: 18,876,146 K273R probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Phf11d T C 14: 59,352,671 D234G probably null Het
Rasa1 A T 13: 85,288,903 probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sec23a A G 12: 59,007,005 V69A probably benign Het
Sipa1 A G 19: 5,659,612 I260T probably damaging Het
Smarcc1 T A 9: 110,190,949 L628H probably damaging Het
Snx31 A G 15: 36,525,584 V323A probably damaging Het
Sun2 A G 15: 79,727,522 S565P probably damaging Het
Tmem74 C T 15: 43,867,168 D160N possibly damaging Het
Tnik T C 3: 28,594,092 M431T probably benign Het
Trp53inp1 A G 4: 11,165,305 T110A probably benign Het
Ttll9 G T 2: 152,984,224 C118F probably benign Het
Vps4b A G 1: 106,791,692 L42P probably benign Het
Xirp2 A T 2: 67,511,906 N1497I probably damaging Het
Xpo4 A G 14: 57,638,307 V123A probably damaging Het
Zfhx4 A T 3: 5,412,425 T3367S probably damaging Het
Zfp236 T C 18: 82,597,688 E1782G possibly damaging Het
Zfp35 T A 18: 24,002,916 C106S possibly damaging Het
Zfpm1 A G 8: 122,336,073 T624A probably benign Het
Zmiz2 C T 11: 6,397,519 Q276* probably null Het
Other mutations in Polq
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Polq APN 16 37065247 splice site probably benign
IGL00539:Polq APN 16 37060569 missense probably damaging 0.98
IGL00960:Polq APN 16 37060512 missense probably damaging 0.96
IGL01100:Polq APN 16 37061112 missense probably benign
IGL01112:Polq APN 16 37017309 missense probably damaging 1.00
IGL01138:Polq APN 16 37045869 missense possibly damaging 0.94
IGL01432:Polq APN 16 37071822 splice site probably benign
IGL01522:Polq APN 16 37027903 missense probably damaging 1.00
IGL01565:Polq APN 16 37013113 missense probably benign 0.00
IGL01592:Polq APN 16 37034850 missense probably benign 0.01
IGL01690:Polq APN 16 37062838 missense probably damaging 0.97
IGL01943:Polq APN 16 37061443 missense possibly damaging 0.47
IGL02531:Polq APN 16 37062374 missense possibly damaging 0.75
IGL02553:Polq APN 16 37041768 missense probably damaging 1.00
IGL02623:Polq APN 16 37060375 missense probably benign 0.04
IGL02692:Polq APN 16 37060627 missense probably damaging 1.00
IGL02717:Polq APN 16 37022740 missense probably damaging 1.00
IGL02937:Polq APN 16 37013109 missense probably benign 0.14
IGL02959:Polq APN 16 37086566 missense probably damaging 1.00
IGL03086:Polq APN 16 37091049 missense probably benign 0.02
IGL03141:Polq APN 16 37017358 splice site probably benign
IGL03302:Polq APN 16 37071772 missense probably damaging 1.00
IGL03393:Polq APN 16 37044794 missense probably damaging 1.00
PIT4403001:Polq UTSW 16 37060587 missense probably benign 0.00
R0013:Polq UTSW 16 37061839 missense possibly damaging 0.56
R0082:Polq UTSW 16 37017257 missense probably benign 0.01
R0212:Polq UTSW 16 37066854 missense probably damaging 0.99
R0387:Polq UTSW 16 37029430 missense probably damaging 1.00
R0387:Polq UTSW 16 37089317 missense probably damaging 1.00
R0427:Polq UTSW 16 37061993 nonsense probably null
R0454:Polq UTSW 16 37034890 missense probably damaging 0.98
R0513:Polq UTSW 16 37094502 missense probably damaging 1.00
R0622:Polq UTSW 16 37060993 missense probably benign 0.02
R0848:Polq UTSW 16 37062130 missense probably benign 0.08
R1142:Polq UTSW 16 37013217 missense probably damaging 0.98
R1218:Polq UTSW 16 37029446 missense possibly damaging 0.93
R1331:Polq UTSW 16 37041747 missense probably damaging 1.00
R1398:Polq UTSW 16 37062495 missense possibly damaging 0.87
R1424:Polq UTSW 16 37086528 missense probably damaging 1.00
R1644:Polq UTSW 16 37060264 missense probably damaging 0.96
R1777:Polq UTSW 16 37060224 missense possibly damaging 0.94
R1820:Polq UTSW 16 37029418 missense possibly damaging 0.48
R1854:Polq UTSW 16 37062109 missense probably benign 0.01
R1880:Polq UTSW 16 37086592 missense possibly damaging 0.90
R1932:Polq UTSW 16 37062304 missense possibly damaging 0.92
R2008:Polq UTSW 16 37062482 missense probably damaging 0.96
R2014:Polq UTSW 16 37078366 missense probably damaging 1.00
R2026:Polq UTSW 16 37062745 missense possibly damaging 0.93
R2178:Polq UTSW 16 37062829 missense probably damaging 1.00
R2259:Polq UTSW 16 37062097 missense probably benign 0.03
R2266:Polq UTSW 16 37062153 missense possibly damaging 0.59
R2305:Polq UTSW 16 37062337 missense probably damaging 0.99
R2370:Polq UTSW 16 37073939 missense probably damaging 1.00
R2504:Polq UTSW 16 37011942 missense unknown
R2517:Polq UTSW 16 37089325 missense probably damaging 1.00
R2697:Polq UTSW 16 37042153 missense probably damaging 1.00
R2858:Polq UTSW 16 37062753 missense possibly damaging 0.88
R3436:Polq UTSW 16 37062337 missense probably damaging 0.99
R3437:Polq UTSW 16 37062337 missense probably damaging 0.99
R3699:Polq UTSW 16 37042156 missense probably damaging 1.00
R3838:Polq UTSW 16 37078349 missense probably damaging 1.00
R3875:Polq UTSW 16 37074027 missense probably damaging 0.99
R4050:Polq UTSW 16 37092820 critical splice acceptor site probably null
R4172:Polq UTSW 16 37060758 missense probably benign 0.02
R4238:Polq UTSW 16 37013181 missense probably damaging 1.00
R4240:Polq UTSW 16 37013181 missense probably damaging 1.00
R4280:Polq UTSW 16 37082057 missense probably damaging 1.00
R4296:Polq UTSW 16 37061301 missense possibly damaging 0.94
R4360:Polq UTSW 16 37060339 missense probably benign 0.00
R4373:Polq UTSW 16 37013181 missense probably damaging 1.00
R4375:Polq UTSW 16 37013181 missense probably damaging 1.00
R4376:Polq UTSW 16 37013181 missense probably damaging 1.00
R4509:Polq UTSW 16 37048563 missense probably damaging 1.00
R4510:Polq UTSW 16 37048563 missense probably damaging 1.00
R4511:Polq UTSW 16 37048563 missense probably damaging 1.00
R4543:Polq UTSW 16 37060785 missense probably benign 0.43
R4633:Polq UTSW 16 37048542 missense probably damaging 1.00
R4739:Polq UTSW 16 37041747 missense probably damaging 1.00
R4834:Polq UTSW 16 37027814 missense probably damaging 1.00
R4841:Polq UTSW 16 37048783 critical splice donor site probably null
R4842:Polq UTSW 16 37048783 critical splice donor site probably null
R4937:Polq UTSW 16 37027912 missense probably benign 0.01
R4955:Polq UTSW 16 37061082 missense probably benign 0.32
R4992:Polq UTSW 16 37061162 missense possibly damaging 0.59
R5008:Polq UTSW 16 37062387 missense probably benign
R5221:Polq UTSW 16 37042178 missense probably damaging 0.98
R5254:Polq UTSW 16 37089319 missense probably damaging 1.00
R5292:Polq UTSW 16 37061383 missense probably damaging 1.00
R5480:Polq UTSW 16 37013290 splice site probably benign
R5552:Polq UTSW 16 37094510 missense possibly damaging 0.93
R5591:Polq UTSW 16 37011885 utr 5 prime probably benign
R5653:Polq UTSW 16 37040534 missense probably damaging 1.00
R5708:Polq UTSW 16 37061018 missense probably damaging 0.98
R5754:Polq UTSW 16 37017263 missense probably benign
R5757:Polq UTSW 16 37086681 missense probably benign 0.01
R5764:Polq UTSW 16 37017344 missense probably damaging 0.97
R6019:Polq UTSW 16 37061764 missense probably damaging 1.00
R6170:Polq UTSW 16 37045812 missense possibly damaging 0.82
R6177:Polq UTSW 16 37071709 missense probably damaging 0.98
R6307:Polq UTSW 16 37017356 critical splice donor site probably null
R6499:Polq UTSW 16 37060827 missense probably benign 0.03
R6520:Polq UTSW 16 37060377 missense possibly damaging 0.88
R6598:Polq UTSW 16 37061631 missense probably benign 0.39
R6694:Polq UTSW 16 37015173 missense probably null 0.99
R6788:Polq UTSW 16 37077148 missense probably damaging 1.00
R7104:Polq UTSW 16 37089353 nonsense probably null
R7159:Polq UTSW 16 37062853 missense possibly damaging 0.87
R7222:Polq UTSW 16 37086633 nonsense probably null
R7340:Polq UTSW 16 37060926 missense probably benign 0.00
R7361:Polq UTSW 16 37060428 missense probably benign 0.00
R7384:Polq UTSW 16 37029418 missense probably damaging 1.00
R7509:Polq UTSW 16 37060343 missense probably benign
R7509:Polq UTSW 16 37060344 missense probably benign 0.00
R7575:Polq UTSW 16 37091134 missense probably benign 0.00
X0060:Polq UTSW 16 37017237 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GAGTGTTTGCTAACAGGGCTC -3'
(R):5'- TCAGCTACATTTTGCAGAGGC -3'

Sequencing Primer
(F):5'- TGCTAACAGGGCTCTAATGTC -3'
(R):5'- CAGCTACATTTTGCAGAGGCTTACAC -3'
Posted On2016-09-06