Incidental Mutation 'R5446:Mroh2a'
ID 429055
Institutional Source Beutler Lab
Gene Symbol Mroh2a
Ensembl Gene ENSMUSG00000079429
Gene Name maestro heat-like repeat family member 2A
Synonyms ENSMUSG00000044873, Heatr7b1, OTTMUSG00000020804
MMRRC Submission 043011-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.937) question?
Stock # R5446 (G1)
Quality Score 83
Status Not validated
Chromosome 1
Chromosomal Location 88154713-88190011 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 88182687 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Isoleucine at position 1205 (N1205I)
Ref Sequence ENSEMBL: ENSMUSP00000130508 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061013] [ENSMUST00000113130] [ENSMUST00000135948]
AlphaFold D3Z750
Predicted Effect possibly damaging
Transcript: ENSMUST00000061013
AA Change: N1205I

PolyPhen 2 Score 0.949 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000130508
Gene: ENSMUSG00000079429
AA Change: N1205I

DomainStartEndE-ValueType
low complexity region 9 26 N/A INTRINSIC
low complexity region 99 112 N/A INTRINSIC
low complexity region 1235 1248 N/A INTRINSIC
SCOP:d1jdha_ 1371 1669 9e-8 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000113130
AA Change: N1202I

PolyPhen 2 Score 0.909 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000108755
Gene: ENSMUSG00000079429
AA Change: N1202I

DomainStartEndE-ValueType
low complexity region 9 26 N/A INTRINSIC
low complexity region 99 112 N/A INTRINSIC
low complexity region 1232 1245 N/A INTRINSIC
SCOP:d1gw5a_ 1446 1671 6e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135948
SMART Domains Protein: ENSMUSP00000118971
Gene: ENSMUSG00000079429

DomainStartEndE-ValueType
SCOP:d1gw5a_ 15 174 5e-6 SMART
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a HEAT-domain-containing protein. The function of the encoded protein has not been characterized. [provided by RefSeq, Aug 2016]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adar A G 3: 89,647,486 (GRCm39) N155S probably damaging Het
Ak9 A G 10: 41,296,505 (GRCm39) D1417G possibly damaging Het
Ankrd52 G T 10: 128,224,430 (GRCm39) C736F probably damaging Het
Arhgap15 T A 2: 43,718,772 (GRCm39) H85Q probably benign Het
Bcat2 G A 7: 45,234,569 (GRCm39) R110H possibly damaging Het
Bscl2 A G 19: 8,823,564 (GRCm39) H4R possibly damaging Het
Cdh2 T C 18: 16,779,684 (GRCm39) I126V probably damaging Het
Cnbd2 A C 2: 156,209,581 (GRCm39) E508A possibly damaging Het
Crb2 T C 2: 37,685,461 (GRCm39) I1191T probably benign Het
Dync2h1 T C 9: 7,144,217 (GRCm39) T1075A probably benign Het
Edil3 A C 13: 89,332,957 (GRCm39) H371P possibly damaging Het
Gm5134 T C 10: 75,831,670 (GRCm39) S370P probably damaging Het
Helz T C 11: 107,523,030 (GRCm39) V737A probably damaging Het
Jade2 A G 11: 51,707,786 (GRCm39) V809A probably benign Het
Klhl23 T A 2: 69,654,582 (GRCm39) C151S probably damaging Het
Krt75 T C 15: 101,479,502 (GRCm39) D276G probably null Het
Lipm C T 19: 34,095,287 (GRCm39) A294V possibly damaging Het
Med13l A G 5: 118,880,462 (GRCm39) N1185D possibly damaging Het
Mmp27 T A 9: 7,573,516 (GRCm39) probably benign Het
Muc21 T A 17: 35,933,395 (GRCm39) probably benign Het
Npnt A G 3: 132,614,130 (GRCm39) L191P probably damaging Het
Or4c10b A T 2: 89,711,893 (GRCm39) H241L probably damaging Het
Paip2b T C 6: 83,791,844 (GRCm39) I13V probably benign Het
Pcdhac2 T A 18: 37,278,253 (GRCm39) L411Q probably damaging Het
Plekhd1 A G 12: 80,767,410 (GRCm39) N266S probably benign Het
Pnpla8 A G 12: 44,337,368 (GRCm39) T454A possibly damaging Het
Prkcg A T 7: 3,378,780 (GRCm39) Y675F probably benign Het
Pwwp2b T A 7: 138,835,066 (GRCm39) I169N probably damaging Het
Rreb1 G A 13: 38,082,473 (GRCm39) R86H possibly damaging Het
Smok3c A C 5: 138,062,895 (GRCm39) L127F probably damaging Het
St6galnac1 T A 11: 116,657,095 (GRCm39) M427L probably benign Het
Synm T C 7: 67,385,722 (GRCm39) T205A probably benign Het
Tsbp1 T C 17: 34,659,867 (GRCm39) probably null Het
Ttn A T 2: 76,641,587 (GRCm39) L5176Q possibly damaging Het
Vmn2r112 A G 17: 22,837,231 (GRCm39) Y564C probably damaging Het
Vmn2r90 A C 17: 17,932,464 (GRCm39) T124P probably damaging Het
Vpreb1a A T 16: 16,686,554 (GRCm39) V112E probably damaging Het
Zfp451 A G 1: 33,816,609 (GRCm39) L447S probably damaging Het
Zfp746 T C 6: 48,041,107 (GRCm39) T539A probably damaging Het
Other mutations in Mroh2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Mroh2a APN 1 88,172,692 (GRCm39) missense probably benign 0.03
IGL00990:Mroh2a APN 1 88,161,842 (GRCm39) missense possibly damaging 0.76
IGL00990:Mroh2a APN 1 88,158,468 (GRCm39) missense probably damaging 0.99
IGL03097:Mroh2a UTSW 1 88,163,098 (GRCm39) missense probably benign 0.30
R0032:Mroh2a UTSW 1 88,183,888 (GRCm39) frame shift probably null
R0068:Mroh2a UTSW 1 88,183,888 (GRCm39) frame shift probably null
R0139:Mroh2a UTSW 1 88,185,524 (GRCm39) missense probably damaging 1.00
R0197:Mroh2a UTSW 1 88,173,764 (GRCm39) missense probably damaging 1.00
R0242:Mroh2a UTSW 1 88,170,142 (GRCm39) missense possibly damaging 0.77
R0322:Mroh2a UTSW 1 88,158,402 (GRCm39) nonsense probably null
R0374:Mroh2a UTSW 1 88,170,142 (GRCm39) missense possibly damaging 0.77
R0387:Mroh2a UTSW 1 88,173,764 (GRCm39) missense probably damaging 1.00
R0412:Mroh2a UTSW 1 88,162,938 (GRCm39) missense probably benign 0.01
R0536:Mroh2a UTSW 1 88,186,386 (GRCm39) missense probably benign 0.00
R0548:Mroh2a UTSW 1 88,170,142 (GRCm39) missense possibly damaging 0.77
R0580:Mroh2a UTSW 1 88,171,672 (GRCm39) missense probably damaging 1.00
R0581:Mroh2a UTSW 1 88,183,888 (GRCm39) frame shift probably null
R0583:Mroh2a UTSW 1 88,183,888 (GRCm39) frame shift probably null
R0613:Mroh2a UTSW 1 88,171,672 (GRCm39) missense probably damaging 1.00
R0652:Mroh2a UTSW 1 88,158,402 (GRCm39) nonsense probably null
R0657:Mroh2a UTSW 1 88,183,287 (GRCm39) missense probably damaging 1.00
R0659:Mroh2a UTSW 1 88,170,142 (GRCm39) missense possibly damaging 0.77
R0659:Mroh2a UTSW 1 88,178,064 (GRCm39) missense probably damaging 1.00
R0671:Mroh2a UTSW 1 88,170,142 (GRCm39) missense possibly damaging 0.77
R0675:Mroh2a UTSW 1 88,156,102 (GRCm39) missense probably damaging 0.99
R0675:Mroh2a UTSW 1 88,178,064 (GRCm39) missense probably damaging 1.00
R0689:Mroh2a UTSW 1 88,186,386 (GRCm39) missense probably benign 0.00
R0689:Mroh2a UTSW 1 88,158,402 (GRCm39) nonsense probably null
R0735:Mroh2a UTSW 1 88,171,672 (GRCm39) missense probably damaging 1.00
R0761:Mroh2a UTSW 1 88,171,672 (GRCm39) missense probably damaging 1.00
R0766:Mroh2a UTSW 1 88,158,402 (GRCm39) nonsense probably null
R0845:Mroh2a UTSW 1 88,186,386 (GRCm39) missense probably benign 0.00
R0853:Mroh2a UTSW 1 88,186,386 (GRCm39) missense probably benign 0.00
R0959:Mroh2a UTSW 1 88,159,979 (GRCm39) frame shift probably null
R0960:Mroh2a UTSW 1 88,170,142 (GRCm39) missense possibly damaging 0.77
R1004:Mroh2a UTSW 1 88,170,142 (GRCm39) missense possibly damaging 0.77
R1013:Mroh2a UTSW 1 88,162,334 (GRCm39) critical splice donor site probably null
R1028:Mroh2a UTSW 1 88,163,098 (GRCm39) missense probably benign 0.30
R1268:Mroh2a UTSW 1 88,158,402 (GRCm39) nonsense probably null
R1281:Mroh2a UTSW 1 88,183,889 (GRCm39) frame shift probably null
R1414:Mroh2a UTSW 1 88,186,386 (GRCm39) missense probably benign 0.00
R1439:Mroh2a UTSW 1 88,185,524 (GRCm39) missense probably damaging 1.00
R1441:Mroh2a UTSW 1 88,169,353 (GRCm39) missense possibly damaging 0.93
R1442:Mroh2a UTSW 1 88,160,075 (GRCm39) splice site probably benign
R1442:Mroh2a UTSW 1 88,170,142 (GRCm39) missense possibly damaging 0.77
R1465:Mroh2a UTSW 1 88,185,524 (GRCm39) missense probably damaging 1.00
R1662:Mroh2a UTSW 1 88,169,340 (GRCm39) missense probably benign 0.07
R1686:Mroh2a UTSW 1 88,158,402 (GRCm39) nonsense probably null
R1686:Mroh2a UTSW 1 88,162,334 (GRCm39) critical splice donor site probably null
R1780:Mroh2a UTSW 1 88,158,402 (GRCm39) nonsense probably null
R1846:Mroh2a UTSW 1 88,186,386 (GRCm39) missense probably benign 0.00
R1899:Mroh2a UTSW 1 88,163,098 (GRCm39) missense probably benign 0.30
R1958:Mroh2a UTSW 1 88,165,213 (GRCm39) nonsense probably null
R2122:Mroh2a UTSW 1 88,184,476 (GRCm39) missense probably benign 0.37
R2248:Mroh2a UTSW 1 88,184,476 (GRCm39) missense probably benign 0.37
R2306:Mroh2a UTSW 1 88,186,386 (GRCm39) missense probably benign 0.00
R2869:Mroh2a UTSW 1 88,159,979 (GRCm39) frame shift probably null
R2870:Mroh2a UTSW 1 88,159,979 (GRCm39) frame shift probably null
R2871:Mroh2a UTSW 1 88,183,287 (GRCm39) missense probably damaging 1.00
R2872:Mroh2a UTSW 1 88,159,979 (GRCm39) frame shift probably null
R3408:Mroh2a UTSW 1 88,159,979 (GRCm39) frame shift probably null
R3608:Mroh2a UTSW 1 88,172,717 (GRCm39) missense probably damaging 1.00
R3730:Mroh2a UTSW 1 88,159,979 (GRCm39) frame shift probably null
R3937:Mroh2a UTSW 1 88,186,386 (GRCm39) missense probably benign 0.00
R4022:Mroh2a UTSW 1 88,173,764 (GRCm39) missense probably damaging 1.00
R4049:Mroh2a UTSW 1 88,186,386 (GRCm39) missense probably benign 0.00
R4133:Mroh2a UTSW 1 88,182,687 (GRCm39) missense possibly damaging 0.95
R4361:Mroh2a UTSW 1 88,182,687 (GRCm39) missense possibly damaging 0.95
R4392:Mroh2a UTSW 1 88,187,311 (GRCm39) missense probably damaging 1.00
R4401:Mroh2a UTSW 1 88,182,657 (GRCm39) missense possibly damaging 0.72
R4402:Mroh2a UTSW 1 88,182,657 (GRCm39) missense possibly damaging 0.72
R4575:Mroh2a UTSW 1 88,186,386 (GRCm39) missense probably benign 0.00
R4625:Mroh2a UTSW 1 88,182,687 (GRCm39) missense possibly damaging 0.95
R4631:Mroh2a UTSW 1 88,186,386 (GRCm39) missense probably benign 0.00
R4665:Mroh2a UTSW 1 88,169,340 (GRCm39) missense probably benign 0.07
R4701:Mroh2a UTSW 1 88,162,334 (GRCm39) critical splice donor site probably null
R4701:Mroh2a UTSW 1 88,169,340 (GRCm39) missense probably benign 0.07
R4771:Mroh2a UTSW 1 88,179,087 (GRCm39) missense probably damaging 1.00
R4795:Mroh2a UTSW 1 88,186,386 (GRCm39) missense probably benign 0.00
R4839:Mroh2a UTSW 1 88,165,666 (GRCm39) missense probably damaging 1.00
R4873:Mroh2a UTSW 1 88,182,657 (GRCm39) missense possibly damaging 0.72
R4875:Mroh2a UTSW 1 88,182,657 (GRCm39) missense possibly damaging 0.72
R4896:Mroh2a UTSW 1 88,184,476 (GRCm39) missense probably benign 0.37
R5007:Mroh2a UTSW 1 88,159,979 (GRCm39) frame shift probably null
R5031:Mroh2a UTSW 1 88,159,979 (GRCm39) frame shift probably null
R5062:Mroh2a UTSW 1 88,159,979 (GRCm39) frame shift probably null
R5301:Mroh2a UTSW 1 88,186,386 (GRCm39) missense probably benign 0.00
R5367:Mroh2a UTSW 1 88,182,687 (GRCm39) missense possibly damaging 0.95
R5371:Mroh2a UTSW 1 88,186,386 (GRCm39) missense probably benign 0.00
R5484:Mroh2a UTSW 1 88,186,386 (GRCm39) missense probably benign 0.00
R5506:Mroh2a UTSW 1 88,186,386 (GRCm39) missense probably benign 0.00
R5561:Mroh2a UTSW 1 88,159,979 (GRCm39) frame shift probably null
R5615:Mroh2a UTSW 1 88,159,979 (GRCm39) frame shift probably null
R5825:Mroh2a UTSW 1 88,158,402 (GRCm39) nonsense probably null
R5891:Mroh2a UTSW 1 88,169,337 (GRCm39) missense possibly damaging 0.93
R5906:Mroh2a UTSW 1 88,186,386 (GRCm39) missense probably benign 0.00
R5928:Mroh2a UTSW 1 88,169,340 (GRCm39) missense probably benign 0.07
R6004:Mroh2a UTSW 1 88,176,377 (GRCm39) missense probably damaging 1.00
R6035:Mroh2a UTSW 1 88,158,390 (GRCm39) missense probably damaging 1.00
R6064:Mroh2a UTSW 1 88,159,979 (GRCm39) frame shift probably null
R6074:Mroh2a UTSW 1 88,186,386 (GRCm39) missense probably benign 0.00
R6091:Mroh2a UTSW 1 88,159,979 (GRCm39) frame shift probably null
R6127:Mroh2a UTSW 1 88,162,334 (GRCm39) critical splice donor site probably null
R6234:Mroh2a UTSW 1 88,184,476 (GRCm39) missense probably benign 0.37
R6234:Mroh2a UTSW 1 88,162,334 (GRCm39) critical splice donor site probably null
R6244:Mroh2a UTSW 1 88,184,476 (GRCm39) missense probably benign 0.37
R6464:Mroh2a UTSW 1 88,185,524 (GRCm39) missense probably damaging 1.00
R6465:Mroh2a UTSW 1 88,159,979 (GRCm39) frame shift probably null
R6575:Mroh2a UTSW 1 88,159,979 (GRCm39) frame shift probably null
R6809:Mroh2a UTSW 1 88,162,938 (GRCm39) missense probably benign 0.01
R6819:Mroh2a UTSW 1 88,170,142 (GRCm39) missense possibly damaging 0.77
R6854:Mroh2a UTSW 1 88,171,672 (GRCm39) missense probably damaging 1.00
R6860:Mroh2a UTSW 1 88,182,657 (GRCm39) missense possibly damaging 0.72
R7126:Mroh2a UTSW 1 88,182,657 (GRCm39) missense possibly damaging 0.72
R7818:Mroh2a UTSW 1 88,162,334 (GRCm39) critical splice donor site probably null
R8350:Mroh2a UTSW 1 88,171,805 (GRCm39) splice site probably null
R9414:Mroh2a UTSW 1 88,179,096 (GRCm39) missense probably benign 0.26
RF024:Mroh2a UTSW 1 88,170,207 (GRCm39) missense probably damaging 1.00
V5622:Mroh2a UTSW 1 88,154,813 (GRCm39) start gained probably benign
V8831:Mroh2a UTSW 1 88,183,889 (GRCm39) frame shift probably null
X0027:Mroh2a UTSW 1 88,176,335 (GRCm39) missense possibly damaging 0.86
X0028:Mroh2a UTSW 1 88,183,888 (GRCm39) frame shift probably null
X0028:Mroh2a UTSW 1 88,159,979 (GRCm39) frame shift probably null
X0033:Mroh2a UTSW 1 88,183,888 (GRCm39) frame shift probably null
X0034:Mroh2a UTSW 1 88,183,888 (GRCm39) frame shift probably null
X0034:Mroh2a UTSW 1 88,160,014 (GRCm39) missense probably damaging 1.00
X0034:Mroh2a UTSW 1 88,159,979 (GRCm39) frame shift probably null
X0039:Mroh2a UTSW 1 88,159,979 (GRCm39) frame shift probably null
X0057:Mroh2a UTSW 1 88,183,888 (GRCm39) frame shift probably null
X0057:Mroh2a UTSW 1 88,183,377 (GRCm39) missense probably benign 0.25
X0057:Mroh2a UTSW 1 88,159,979 (GRCm39) frame shift probably null
X0063:Mroh2a UTSW 1 88,159,979 (GRCm39) frame shift probably null
Z1188:Mroh2a UTSW 1 88,162,938 (GRCm39) missense probably benign 0.01
Z1190:Mroh2a UTSW 1 88,159,979 (GRCm39) frame shift probably null
Z1192:Mroh2a UTSW 1 88,162,938 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CAACTCTTTGCTTAGGGGTCCC -3'
(R):5'- CAGGTCAGGAAACAGGTCTG -3'

Sequencing Primer
(F):5'- CCAGGGGGTGTCACGAG -3'
(R):5'- CAGGTCTGGAAATTTGTCATCC -3'
Posted On 2016-09-06