Mutagenetix > Incidental Mutation

Incidental Mutation 'R5446:Arhgap15'

429058

Institutional Source

Beutler Lab

Gene Symbol

Arhgap15

Ensembl Gene

ENSMUSG00000049744

Gene Name

Rho GTPase activating protein 15

Synonyms

MMRRC Submission

043011-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.428) question?

Stock #

R5446 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

43748824-44395953 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 43828760 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Glutamine at position 85 (H85Q)

Ref Sequence

ENSEMBL: ENSMUSP00000108443 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000055776] [ENSMUST00000112822] [ENSMUST00000112824]

AlphaFold

Q811M1

Predicted Effect

probably benign
Transcript: ENSMUST00000055776
AA Change: H85Q

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000056461
Gene: ENSMUSG00000049744
AA Change: H85Q

Domain	Start	End	E-Value	Type
PH	88	199	1.24e-9	SMART
RhoGAP	298	473	1.55e-63	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000112822
AA Change: H85Q

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000108441
Gene: ENSMUSG00000049744
AA Change: H85Q

Domain	Start	End	E-Value	Type
Blast:PH	88	108	5e-6	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000112824
AA Change: H85Q

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000108443
Gene: ENSMUSG00000049744
AA Change: H85Q

Domain	Start	End	E-Value	Type
PH	88	199	1.24e-9	SMART
RhoGAP	298	469	1.16e-35	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000140528

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.8%

Validation Efficiency

MGI Phenotype

FUNCTION: The protein encoded by this gene is a RAC GTPase-activating protein that is regulated through its PH domain and by recruitment to the membrane. The protein accelerates hydrolysis of guanosine triphosphate to guanosine diphosphate to repress Rac activity. Knock-out of Arhgap15 function demonstrates that this gene is required to regulate multiple functions in macrophages and neutrophils. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2014]
PHENOTYPE: Mice homozygous for disruption of this gene display reduced leukocyte numbers and abnormally shaped macrophage. Chemotactic responses of macrophage are normal while neutrophile chemoattraction and bacterial pagocytosis are increased. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 39 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adar	A	G	3: 89,740,179	N155S	probably damaging	Het
Ak9	A	G	10: 41,420,509	D1417G	possibly damaging	Het
Ankrd52	G	T	10: 128,388,561	C736F	probably damaging	Het
BC051142	T	C	17: 34,440,893		probably null	Het
Bcat2	G	A	7: 45,585,145	R110H	possibly damaging	Het
Bscl2	A	G	19: 8,846,200	H4R	possibly damaging	Het
Cdh2	T	C	18: 16,646,627	I126V	probably damaging	Het
Cnbd2	A	C	2: 156,367,661	E508A	possibly damaging	Het
Crb2	T	C	2: 37,795,449	I1191T	probably benign	Het
Dync2h1	T	C	9: 7,144,217	T1075A	probably benign	Het
Edil3	A	C	13: 89,184,838	H371P	possibly damaging	Het
Gm5134	T	C	10: 75,995,836	S370P	probably damaging	Het
Gm9573	T	A	17: 35,622,503		probably benign	Het
Helz	T	C	11: 107,632,204	V737A	probably damaging	Het
Jade2	A	G	11: 51,816,959	V809A	probably benign	Het
Klhl23	T	A	2: 69,824,238	C151S	probably damaging	Het
Krt75	T	C	15: 101,571,067	D276G	probably null	Het
Lipm	C	T	19: 34,117,887	A294V	possibly damaging	Het
Med13l	A	G	5: 118,742,397	N1185D	possibly damaging	Het
Mmp27	T	A	9: 7,573,515		probably benign	Het
Mroh2a	A	T	1: 88,254,965	N1205I	possibly damaging	Het
Npnt	A	G	3: 132,908,369	L191P	probably damaging	Het
Olfr1257	A	T	2: 89,881,549	H241L	probably damaging	Het
Paip2b	T	C	6: 83,814,862	I13V	probably benign	Het
Pcdhac2	T	A	18: 37,145,200	L411Q	probably damaging	Het
Plekhd1	A	G	12: 80,720,636	N266S	probably benign	Het
Pnpla8	A	G	12: 44,290,585	T454A	possibly damaging	Het
Prkcg	A	T	7: 3,330,264	Y675F	probably benign	Het
Pwwp2b	T	A	7: 139,255,150	I169N	probably damaging	Het
Rreb1	G	A	13: 37,898,497	R86H	possibly damaging	Het
Smok3c	A	C	5: 138,064,633	L127F	probably damaging	Het
St6galnac1	T	A	11: 116,766,269	M427L	probably benign	Het
Synm	T	C	7: 67,735,974	T205A	probably benign	Het
Ttn	A	T	2: 76,811,243	L5176Q	possibly damaging	Het
Vmn2r112	A	G	17: 22,618,250	Y564C	probably damaging	Het
Vmn2r90	A	C	17: 17,712,202	T124P	probably damaging	Het
Vpreb1	A	T	16: 16,868,690	V112E	probably damaging	Het
Zfp451	A	G	1: 33,777,528	L447S	probably damaging	Het
Zfp746	T	C	6: 48,064,173	T539A	probably damaging	Het

Other mutations in Arhgap15

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01533:Arhgap15	APN	2	44243153	missense	probably damaging	1.00
IGL01779:Arhgap15	APN	2	44065045	missense	possibly damaging	0.94
IGL02011:Arhgap15	APN	2	43780755	missense	probably damaging	1.00
IGL02506:Arhgap15	APN	2	44063808	missense	possibly damaging	0.73
IGL02659:Arhgap15	APN	2	44063837	missense	probably damaging	1.00
IGL02711:Arhgap15	APN	2	44116662	missense	possibly damaging	0.67
IGL02944:Arhgap15	APN	2	44142350	critical splice donor site	probably null
IGL02989:Arhgap15	APN	2	43780736	missense	probably damaging	1.00
PIT4468001:Arhgap15	UTSW	2	44243131	missense	probably damaging	1.00
R0140:Arhgap15	UTSW	2	44322767	missense	probably damaging	1.00
R0403:Arhgap15	UTSW	2	44063766	missense	probably damaging	0.98
R0557:Arhgap15	UTSW	2	44116617	missense	possibly damaging	0.60
R0616:Arhgap15	UTSW	2	44116717	critical splice donor site	probably null
R1122:Arhgap15	UTSW	2	44142295	missense	probably benign	0.43
R1958:Arhgap15	UTSW	2	44243124	missense	possibly damaging	0.67
R2258:Arhgap15	UTSW	2	44386347	missense	probably damaging	1.00
R2905:Arhgap15	UTSW	2	44063786	missense	probably damaging	0.97
R4788:Arhgap15	UTSW	2	43748890	start codon destroyed	probably null	0.02
R4793:Arhgap15	UTSW	2	44142341	missense	probably damaging	1.00
R5040:Arhgap15	UTSW	2	43844813	critical splice donor site	probably null
R5093:Arhgap15	UTSW	2	44322755	missense	probably damaging	1.00
R5114:Arhgap15	UTSW	2	43780618	missense	probably benign	0.03
R5202:Arhgap15	UTSW	2	44063857	missense	probably benign	0.22
R5661:Arhgap15	UTSW	2	44322727	missense	possibly damaging	0.54
R6747:Arhgap15	UTSW	2	44116677	missense	probably damaging	1.00
R7392:Arhgap15	UTSW	2	44063774	missense	possibly damaging	0.61
R7502:Arhgap15	UTSW	2	43780618	missense	probably benign	0.03
R7630:Arhgap15	UTSW	2	43780636	missense	probably benign	0.01
R7658:Arhgap15	UTSW	2	44142268	missense	probably benign	0.18
R7735:Arhgap15	UTSW	2	44116630	missense	probably damaging	1.00
R8734:Arhgap15	UTSW	2	44243118	missense	probably damaging	1.00
R8743:Arhgap15	UTSW	2	43748864	start gained	probably benign

Predicted Primers

PCR Primer
(F):5'- TTGCACCCAGCCATATTGT -3'
(R):5'- TGCAGAACACTCACATCCAAGATTT -3'

Sequencing Primer
(F):5'- CATATTGACTAAATTGTGCTCA -3'
(R):5'- TGAGCTTGACACTACCTCAGTCAG -3'

Posted On

2016-09-06