Incidental Mutation 'R5446:Arhgap15'
ID 429058
Institutional Source Beutler Lab
Gene Symbol Arhgap15
Ensembl Gene ENSMUSG00000049744
Gene Name Rho GTPase activating protein 15
Synonyms
MMRRC Submission 043011-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.428) question?
Stock # R5446 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 43748824-44395953 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 43828760 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Glutamine at position 85 (H85Q)
Ref Sequence ENSEMBL: ENSMUSP00000108443 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055776] [ENSMUST00000112822] [ENSMUST00000112824]
AlphaFold Q811M1
Predicted Effect probably benign
Transcript: ENSMUST00000055776
AA Change: H85Q

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000056461
Gene: ENSMUSG00000049744
AA Change: H85Q

DomainStartEndE-ValueType
PH 88 199 1.24e-9 SMART
RhoGAP 298 473 1.55e-63 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112822
AA Change: H85Q

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000108441
Gene: ENSMUSG00000049744
AA Change: H85Q

DomainStartEndE-ValueType
Blast:PH 88 108 5e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000112824
AA Change: H85Q

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000108443
Gene: ENSMUSG00000049744
AA Change: H85Q

DomainStartEndE-ValueType
PH 88 199 1.24e-9 SMART
RhoGAP 298 469 1.16e-35 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140528
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is a RAC GTPase-activating protein that is regulated through its PH domain and by recruitment to the membrane. The protein accelerates hydrolysis of guanosine triphosphate to guanosine diphosphate to repress Rac activity. Knock-out of Arhgap15 function demonstrates that this gene is required to regulate multiple functions in macrophages and neutrophils. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2014]
PHENOTYPE: Mice homozygous for disruption of this gene display reduced leukocyte numbers and abnormally shaped macrophage. Chemotactic responses of macrophage are normal while neutrophile chemoattraction and bacterial pagocytosis are increased. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adar A G 3: 89,740,179 N155S probably damaging Het
Ak9 A G 10: 41,420,509 D1417G possibly damaging Het
Ankrd52 G T 10: 128,388,561 C736F probably damaging Het
BC051142 T C 17: 34,440,893 probably null Het
Bcat2 G A 7: 45,585,145 R110H possibly damaging Het
Bscl2 A G 19: 8,846,200 H4R possibly damaging Het
Cdh2 T C 18: 16,646,627 I126V probably damaging Het
Cnbd2 A C 2: 156,367,661 E508A possibly damaging Het
Crb2 T C 2: 37,795,449 I1191T probably benign Het
Dync2h1 T C 9: 7,144,217 T1075A probably benign Het
Edil3 A C 13: 89,184,838 H371P possibly damaging Het
Gm5134 T C 10: 75,995,836 S370P probably damaging Het
Gm9573 T A 17: 35,622,503 probably benign Het
Helz T C 11: 107,632,204 V737A probably damaging Het
Jade2 A G 11: 51,816,959 V809A probably benign Het
Klhl23 T A 2: 69,824,238 C151S probably damaging Het
Krt75 T C 15: 101,571,067 D276G probably null Het
Lipm C T 19: 34,117,887 A294V possibly damaging Het
Med13l A G 5: 118,742,397 N1185D possibly damaging Het
Mmp27 T A 9: 7,573,515 probably benign Het
Mroh2a A T 1: 88,254,965 N1205I possibly damaging Het
Npnt A G 3: 132,908,369 L191P probably damaging Het
Olfr1257 A T 2: 89,881,549 H241L probably damaging Het
Paip2b T C 6: 83,814,862 I13V probably benign Het
Pcdhac2 T A 18: 37,145,200 L411Q probably damaging Het
Plekhd1 A G 12: 80,720,636 N266S probably benign Het
Pnpla8 A G 12: 44,290,585 T454A possibly damaging Het
Prkcg A T 7: 3,330,264 Y675F probably benign Het
Pwwp2b T A 7: 139,255,150 I169N probably damaging Het
Rreb1 G A 13: 37,898,497 R86H possibly damaging Het
Smok3c A C 5: 138,064,633 L127F probably damaging Het
St6galnac1 T A 11: 116,766,269 M427L probably benign Het
Synm T C 7: 67,735,974 T205A probably benign Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Vmn2r112 A G 17: 22,618,250 Y564C probably damaging Het
Vmn2r90 A C 17: 17,712,202 T124P probably damaging Het
Vpreb1 A T 16: 16,868,690 V112E probably damaging Het
Zfp451 A G 1: 33,777,528 L447S probably damaging Het
Zfp746 T C 6: 48,064,173 T539A probably damaging Het
Other mutations in Arhgap15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01533:Arhgap15 APN 2 44243153 missense probably damaging 1.00
IGL01779:Arhgap15 APN 2 44065045 missense possibly damaging 0.94
IGL02011:Arhgap15 APN 2 43780755 missense probably damaging 1.00
IGL02506:Arhgap15 APN 2 44063808 missense possibly damaging 0.73
IGL02659:Arhgap15 APN 2 44063837 missense probably damaging 1.00
IGL02711:Arhgap15 APN 2 44116662 missense possibly damaging 0.67
IGL02944:Arhgap15 APN 2 44142350 critical splice donor site probably null
IGL02989:Arhgap15 APN 2 43780736 missense probably damaging 1.00
PIT4468001:Arhgap15 UTSW 2 44243131 missense probably damaging 1.00
R0140:Arhgap15 UTSW 2 44322767 missense probably damaging 1.00
R0403:Arhgap15 UTSW 2 44063766 missense probably damaging 0.98
R0557:Arhgap15 UTSW 2 44116617 missense possibly damaging 0.60
R0616:Arhgap15 UTSW 2 44116717 critical splice donor site probably null
R1122:Arhgap15 UTSW 2 44142295 missense probably benign 0.43
R1958:Arhgap15 UTSW 2 44243124 missense possibly damaging 0.67
R2258:Arhgap15 UTSW 2 44386347 missense probably damaging 1.00
R2905:Arhgap15 UTSW 2 44063786 missense probably damaging 0.97
R4788:Arhgap15 UTSW 2 43748890 start codon destroyed probably null 0.02
R4793:Arhgap15 UTSW 2 44142341 missense probably damaging 1.00
R5040:Arhgap15 UTSW 2 43844813 critical splice donor site probably null
R5093:Arhgap15 UTSW 2 44322755 missense probably damaging 1.00
R5114:Arhgap15 UTSW 2 43780618 missense probably benign 0.03
R5202:Arhgap15 UTSW 2 44063857 missense probably benign 0.22
R5661:Arhgap15 UTSW 2 44322727 missense possibly damaging 0.54
R6747:Arhgap15 UTSW 2 44116677 missense probably damaging 1.00
R7392:Arhgap15 UTSW 2 44063774 missense possibly damaging 0.61
R7502:Arhgap15 UTSW 2 43780618 missense probably benign 0.03
R7630:Arhgap15 UTSW 2 43780636 missense probably benign 0.01
R7658:Arhgap15 UTSW 2 44142268 missense probably benign 0.18
R7735:Arhgap15 UTSW 2 44116630 missense probably damaging 1.00
R8734:Arhgap15 UTSW 2 44243118 missense probably damaging 1.00
R8743:Arhgap15 UTSW 2 43748864 start gained probably benign
Predicted Primers PCR Primer
(F):5'- TTGCACCCAGCCATATTGT -3'
(R):5'- TGCAGAACACTCACATCCAAGATTT -3'

Sequencing Primer
(F):5'- CATATTGACTAAATTGTGCTCA -3'
(R):5'- TGAGCTTGACACTACCTCAGTCAG -3'
Posted On 2016-09-06