Incidental Mutation 'R5446:Klhl23'
ID 429060
Institutional Source Beutler Lab
Gene Symbol Klhl23
Ensembl Gene ENSMUSG00000042155
Gene Name kelch-like 23
Synonyms
MMRRC Submission 043011-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.134) question?
Stock # R5446 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 69821944-69836651 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 69824238 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Serine at position 151 (C151S)
Ref Sequence ENSEMBL: ENSMUSP00000050219 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053087]
AlphaFold Q6GQU2
Predicted Effect probably damaging
Transcript: ENSMUST00000053087
AA Change: C151S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000050219
Gene: ENSMUSG00000042155
AA Change: C151S

DomainStartEndE-ValueType
BTB 36 134 8.34e-27 SMART
BACK 139 240 8.51e-23 SMART
Kelch 274 319 5.19e0 SMART
Kelch 321 369 5.85e-10 SMART
Kelch 370 416 7.78e-6 SMART
Kelch 417 466 2.11e-1 SMART
Kelch 467 508 3.8e-9 SMART
Kelch 509 557 2.25e-11 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135759
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152898
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adar A G 3: 89,740,179 N155S probably damaging Het
Ak9 A G 10: 41,420,509 D1417G possibly damaging Het
Ankrd52 G T 10: 128,388,561 C736F probably damaging Het
Arhgap15 T A 2: 43,828,760 H85Q probably benign Het
BC051142 T C 17: 34,440,893 probably null Het
Bcat2 G A 7: 45,585,145 R110H possibly damaging Het
Bscl2 A G 19: 8,846,200 H4R possibly damaging Het
Cdh2 T C 18: 16,646,627 I126V probably damaging Het
Cnbd2 A C 2: 156,367,661 E508A possibly damaging Het
Crb2 T C 2: 37,795,449 I1191T probably benign Het
Dync2h1 T C 9: 7,144,217 T1075A probably benign Het
Edil3 A C 13: 89,184,838 H371P possibly damaging Het
Gm5134 T C 10: 75,995,836 S370P probably damaging Het
Gm9573 T A 17: 35,622,503 probably benign Het
Helz T C 11: 107,632,204 V737A probably damaging Het
Jade2 A G 11: 51,816,959 V809A probably benign Het
Krt75 T C 15: 101,571,067 D276G probably null Het
Lipm C T 19: 34,117,887 A294V possibly damaging Het
Med13l A G 5: 118,742,397 N1185D possibly damaging Het
Mmp27 T A 9: 7,573,515 probably benign Het
Mroh2a A T 1: 88,254,965 N1205I possibly damaging Het
Npnt A G 3: 132,908,369 L191P probably damaging Het
Olfr1257 A T 2: 89,881,549 H241L probably damaging Het
Paip2b T C 6: 83,814,862 I13V probably benign Het
Pcdhac2 T A 18: 37,145,200 L411Q probably damaging Het
Plekhd1 A G 12: 80,720,636 N266S probably benign Het
Pnpla8 A G 12: 44,290,585 T454A possibly damaging Het
Prkcg A T 7: 3,330,264 Y675F probably benign Het
Pwwp2b T A 7: 139,255,150 I169N probably damaging Het
Rreb1 G A 13: 37,898,497 R86H possibly damaging Het
Smok3c A C 5: 138,064,633 L127F probably damaging Het
St6galnac1 T A 11: 116,766,269 M427L probably benign Het
Synm T C 7: 67,735,974 T205A probably benign Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Vmn2r112 A G 17: 22,618,250 Y564C probably damaging Het
Vmn2r90 A C 17: 17,712,202 T124P probably damaging Het
Vpreb1 A T 16: 16,868,690 V112E probably damaging Het
Zfp451 A G 1: 33,777,528 L447S probably damaging Het
Zfp746 T C 6: 48,064,173 T539A probably damaging Het
Other mutations in Klhl23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02582:Klhl23 APN 2 69824238 missense probably damaging 1.00
IGL02637:Klhl23 APN 2 69828914 nonsense probably null
R0128:Klhl23 UTSW 2 69833966 missense probably damaging 0.97
R0130:Klhl23 UTSW 2 69833966 missense probably damaging 0.97
R0333:Klhl23 UTSW 2 69833897 missense probably damaging 1.00
R0538:Klhl23 UTSW 2 69824413 missense probably benign 0.01
R1466:Klhl23 UTSW 2 69833888 missense probably damaging 1.00
R1466:Klhl23 UTSW 2 69833888 missense probably damaging 1.00
R1584:Klhl23 UTSW 2 69833888 missense probably damaging 1.00
R1970:Klhl23 UTSW 2 69833686 missense probably damaging 1.00
R2102:Klhl23 UTSW 2 69828884 missense probably damaging 1.00
R4236:Klhl23 UTSW 2 69824172 missense probably damaging 0.98
R4473:Klhl23 UTSW 2 69823807 missense possibly damaging 0.67
R5852:Klhl23 UTSW 2 69824269 missense probably benign 0.44
R6143:Klhl23 UTSW 2 69833696 missense possibly damaging 0.65
R6151:Klhl23 UTSW 2 69824854 missense probably damaging 0.99
R6277:Klhl23 UTSW 2 69833752 missense probably damaging 1.00
R7030:Klhl23 UTSW 2 69833966 missense probably damaging 1.00
R7303:Klhl23 UTSW 2 69824701 missense probably benign 0.42
R7724:Klhl23 UTSW 2 69824712 missense probably benign 0.00
R8330:Klhl23 UTSW 2 69824152 missense probably damaging 0.98
R8913:Klhl23 UTSW 2 69833890 missense probably damaging 1.00
R9067:Klhl23 UTSW 2 69833739 missense possibly damaging 0.94
R9720:Klhl23 UTSW 2 69824460 missense possibly damaging 0.78
X0066:Klhl23 UTSW 2 69823788 start codon destroyed possibly damaging 0.75
Predicted Primers PCR Primer
(F):5'- TAAAACTGTCGGGCATCCACC -3'
(R):5'- TCGTGAGCAGTCCACTTAATGAC -3'

Sequencing Primer
(F):5'- CCACCATGATATTTTGGAAGGCC -3'
(R):5'- GTCCACTTAATGACCGGCTCTAAG -3'
Posted On 2016-09-06